Kallikrein 11 (KLK11) (NM_001167605) Human Untagged Clone

CAT#: SC328448

KLK11 (untagged)-Human kallikrein-related peptidase 11 (KLK11) transcript variant 3


  "NM_001167605" in other vectors (4)

Reconstitution Protocol

USD 660.00

3 Weeks*

Size
    • 10 ug

Product Images

Other products for "KLK11"

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Symbol KLK11
Synonyms PRSS20; TLSP
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>NCBI ORF sequence for NM_001167605, the custom clone sequence may differ by one or more nucleotides


ATGAGGATTCTGCAGTTAATCCTGCTTGCTCTGGCAACAGGGCTTGTAGGGGGAGAGACCAGGATCATCA
AGGGGTTCGAGTGCAAGCCTCACTCCCAGCCCTGGCAGGCAGCCCTGTTCGAGAAGACGCGGCTACTCTG
TGGGGCGACGCTCATCGCCCCCAGATGGCTCCTGACAGCAGCCCACTGCCTCAAGCCGTGGGTGTCACTC
ACCTCTCCCACCCATGTCTCCCCCGACCTTTCCTCCTCCAACTACTGTCTCTCCCACCTCAGCCGCTACA
TAGTTCACCTGGGGCAGCACAACCTCCAGAAGGAGGAGGGCTGTGAGCAGACCCGGACAGCCACTGAGTC
CTTCCCCCACCCCGGCTTCAACAACAGCCTCCCCAACAAAGACCACCGCAATGACATCATGCTGGTGAAG
ATGGCATCGCCAGTCTCCATCACCTGGGCTGTGCGACCCCTCACCCTCTCCTCACGCTGTGTCACTGCTG
GCACCAGCTGCCTCATTTCCGGCTGGGGCAGCACGTCCAGCCCCCAGTTACGCCTGCCTCACACCTTGCG
ATGCGCCAACATCACCATCATTGAGCACCAGAAGTGTGAGAACGCCTACCCCGGCAACATCACAGACACC
ATGGTGTGTGCCAGCGTGCAGGAAGGGGGCAAGGACTCCTGCCAGGGTGACTCCGGGGGCCCTCTGGTCT
GTAACCAGTCTCTTCAAGGCATTATCTCCTGGGGCCAGGATCCGTGTGCGATCACCCGAAAGCCTGGTGT
CTACACGAAAGTCTGCAAATATGTGGACTGGATCCAGGAGACGATGAAGAACAATTAG


Restriction Sites SgfI-MluI     
ACCN NM_001167605
ORF Size 828 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Reference Data
RefSeq NM_001167605.1, NP_001161077.1
RefSeq Size 1282
RefSeq ORF 828
Locus ID 11012
Protein Families Druggable Genome, Protease, Secreted Protein
Gene Summary Kallikreins are a subgroup of serine proteases having diverse physiological functions. Growing evidence suggests that many kallikreins are implicated in carcinogenesis and some have potential as novel cancer and other disease biomarkers. This gene is one of the fifteen kallikrein subfamily members located in a cluster on chromosome 19. Alternate splicing and the use of alternate promoters results in multiple transcript variants encoding distinct isoforms which are differentially expressed. [provided by RefSeq, Dec 2016]
Transcript Variant: This variant (3) has an alternate 5' terminal exon, which results in a downstream translation start codon, and has an alternate splice junction in the coding region, compared to variant 2. The encoded isoform (3) has a shorter N-terminus and an additional internal segment, compared to isoform 2.

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.