Syntaxin 3 (STX3) (NM_001178040) Human Untagged Clone

CAT#: SC328449

STX3 (untagged)-Human syntaxin 3 (STX3) transcript variant 2

Specifications

Product Data

• Type: Human Untagged Clone
• Tag: Tag Free
• Symbol: STX3
• Synonyms: STX3A
• Vector: pCMV6-Entry
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Sequence Data:
  Fully Sequenced ORF

  >NCBI ORF sequence for NM_001178040, the custom clone sequence may differ by one or more nucleotides
  
  
  ATGAAGGACCGTCTGGAGCAGCTGAAGGCCAAGCAGCTGACACAGGATGATGATACTGATGCGGTTGAGA
  TTGCTATCGACAACACGGCTTTTATGGACGAGTTCTTTTCTGAGATTGAGGAAACTCGGCTTAACATTGA
  CAAGATCTCAGAACATGTAGAGGAGGCTAAGAAACTCTACAGTATCATTCTCTCTGCACCGATTCCAGAG
  CCAAAAACCAAGGATGACCTAGAGCAGCTCACGACTGAGATTAAGAAAAGGGCCAACAACGTCCGGAACA
  AACTGAAGAGCATGGAGAAGCATATTGAAGAAGATGAGGTCAGGTCATCGGCAGACCTTCGGATTCGGAA
  ATCCCAGCACTCTGTCCTTTCTCGGAAGTTTGTGGAGGTGATGACCAAATACAATGAAGCTCAAGTGGAC
  TTCCGAGAACGCAGCAAAGGGCGAATCCAGCGGCAGCTCGAAATTACTGGCAAAAAGACAACCGATGAGG
  AGCTGGAGGAGATGTTGGAGAGTGGCAACCCGGCCATCTTCACTTCTGGGATCATTGACTCACAGATTTC
  CAAGCAAGCCCTCAGTGAGATTGAGGGACGACACAAGGACATTGTGAGGCTGGAGAGCAGCATCAAGGAG
  CTTCACGACATGTTTATGGACATCGCCATGCTGGTGGAGAATCAGGGTGAGATGTTAGATAACATAGAGT
  TGAATGTCATGCACACAGTGGACCACGTGGAGAAGGCACGAGATGAAACGAAAAAAGCTGTGAAATACCA
  GAGTCAGGCCCGGAAGAAACTGATTTCACTCCAGACTGGTGTGGCCACCCTTGTCTTCAGATGA
  
  
• Restriction Sites: SgfI-MluI
• ACCN: NM_001178040
• ORF Size: 834 bp
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
• OTI Annotation: This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.

Reference Data

• RefSeq: NM_001178040.1, NP_001171511.1
• RefSeq Size: 6384
• RefSeq ORF: 834
• Locus ID: 6809
• Protein Families: Druggable Genome, Stem cell - Pluripotency, Transmembrane
• Protein Pathways: SNARE interactions in vesicular transport
• Gene Summary: The gene is a member of the syntaxin family. The encoded protein is targeted to the apical membrane of epithelial cells where it forms clusters and is important in establishing and maintaining polarity necessary for protein trafficking involving vesicle fusion and exocytosis. Alternative splicing results in multiple transcript variants. [provided by RefSeq, May 2010]
  Transcript Variant: This variant (2) lacks an exon in the coding region, which results in a frameshift in the 3' coding region, compared to variant 1. The resulting protein (isoform 2) is shorter and has a distinct C-terminus, compared to isoform 1. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments.