G protein alpha Inhibitor 2 (GNAI2) (NM_001166425) Human Untagged Clone

CAT#: SC328514

GNAI2 (untagged)-Human guanine nucleotide binding protein (G protein) alpha inhibiting activity polypeptide 2 (GNAI2) transcript variant 2


  "NM_001166425" in other vectors (6)

Reconstitution Protocol

USD 660.00

3 Weeks*

Size
    • 10 ug

Product Images

Other products for "GNAI2"

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Symbol GNAI2
Synonyms GIP; GNAI2B; H_LUCA15.1; H_LUCA16.1
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>NCBI ORF sequence for NM_001166425, the custom clone sequence may differ by one or more nucleotides


ATGAGAGGTGCTGGGGAGTCAGGGAAGAGCACCATCGTCAAGCAGATGAAGATCATCCACGAGGATGGCT
ACTCCGAGGAGGAATGCCGGCAGTACCGGGCGGTTGTCTACAGCAACACCATCCAGTCCATCATGGCCAT
TGTCAAAGCCATGGGCAACCTGCAGATCGACTTTGCCGACCCCTCCAGAGCGGACGACGCCAGGCAGCTA
TTTGCACTGTCCTGCACCGCCGAGGAGCAAGGCGTGCTCCCTGATGACCTGTCCGGCGTCATCCGGAGGC
TCTGGGCTGACCATGGTGTGCAGGCCTGCTTTGGCCGCTCAAGGGAATACCAGCTCAACGACTCAGCTGC
CTACTACCTGAACGACCTGGAGCGTATTGCACAGAGTGACTACATCCCCACACAGCAAGATGTGCTACGG
ACCCGCGTAAAGACCACGGGGATCGTGGAGACACACTTCACCTTCAAGGACCTACACTTCAAGATGTTTG
ATGTGGGTGGTCAGCGGTCTGAGCGGAAGAAGTGGATCCACTGCTTTGAGGGCGTCACAGCCATCATCTT
CTGCGTAGCCTTGAGCGCCTATGACTTGGTGCTAGCTGAGGACGAGGAGATGAACCGCATGCATGAGAGC
ATGAAGCTATTCGATAGCATCTGCAACAACAAGTGGTTCACAGACACGTCCATCATCCTCTTCCTCAACA
AGAAGGACCTGTTTGAGGAGAAGATCACACACAGTCCCCTGACCATCTGCTTCCCTGAGTACACAGGGGC
CAACAAATATGATGAGGCAGCCAGCTACATCCAGAGTAAGTTTGAGGACCTGAATAAGCGCAAAGACACC
AAGGAGATCTACACGCACTTCACGTGCGCCACCGACACCAAGAACGTGCAGTTCGTGTTTGACGCCGTCA
CCGATGTCATCATCAAGAACAACCTGAAGGACTGCGGCCTCTTCTGA


Restriction Sites SgfI-MluI     
ACCN NM_001166425
ORF Size 957 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Reference Data
RefSeq NM_001166425.1, NP_001159897.1
RefSeq Size 2143
RefSeq ORF 957
Locus ID 2771
Protein Families Druggable Genome
Protein Pathways Axon guidance, Chemokine signaling pathway, Gap junction, Leukocyte transendothelial migration, Long-term depression, Melanogenesis, Progesterone-mediated oocyte maturation, Tight junction
Gene Summary The protein encoded by this gene is an alpha subunit of guanine nucleotide binding proteins (G proteins). The encoded protein contains the guanine nucleotide binding site and is involved in the hormonal regulation of adenylate cyclase. Several transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Sep 2013]
Transcript Variant: This variant (2) differs in the 5' UTR and coding sequence compared to variant 1. The resulting isoform (2) has a shorter and distinct N-terminus compared to isoform 1.

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.