BCAT1 (NM_001178092) Human Untagged Clone
CAT#: SC328529
BCAT1 (untagged)-Human branched chain amino-acid transaminase 1 cytosolic (BCAT1) transcript variant 3
"NM_001178092" in other vectors (4)
Product Images
![](https://cdn.origene.com/img/defaults-img-expression-plasmids.jpg)
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Symbol | BCAT1 |
Synonyms | BCATC; BCT1; ECA39; MECA39; PNAS121; PP18 |
Vector | pCMV6-Entry |
E. coli Selection | Kanamycin (25 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>NCBI ORF sequence for NM_001178092, the custom clone sequence may differ by one or more nucleotides
ATGAAGGCTAAAGACCTAATAGTCACACCAGCTACCATTTTAAAGGAAAAACCAGACCCCAATAATCTGG TTTTTGGAACTGTGTTCACGGATCATATGCTGACGGTGGAGTGGTCCTCAGAGTTTGGATGGGAGAAACC TCATATCAAGCCTCTTCAGAACCTGTCATTGCACCCTGGCTCATCAGCTTTGCACTATGCAGTGGAAGTA TTTGACAAAGAAGAGCTCTTAGAGTGTATTCAACAGCTTGTGAAATTGGATCAAGAATGGGTCCCATATT CAACATCTGCTAGTCTGTATATTCGTCCTACATTCATTGGAACTGAGCCTTCTCTTGGAGTCAAGAAGCC TACCAAAGCCCTGCTCTTTGTACTCTTGAGCCCAGTGGGACCTTATTTTTCAAGTGGAACCTTTAATCCA GTGTCCCTGTGGGCCAATCCCAAGTATGTAAGAGCCTGGAAAGGTGGAACTGGGGACTGCAAGATGGGAG GGAATTACGGCTCATCTCTTTTTGCCCAATGTGAAGCAGTAGATAATGGGTGTCAGCAGGTCCTGTGGCT CTATGGAGAGGACCATCAGATCACTGAAGTGGGAACTATGAATCTTTTTCTTTACTGGATAAATGAAGAT GGAGAAGAAGAACTGGCAACTCCTCCACTAGATGGCATCATTCTTCCAGGAGTGACAAGGCGGTGCATTC TGGACCTGGCACATCAGTGGGGTGAATTTAAGGTGTCAGAGAGATACCTCACCATGGATGACTTGACAAC AGCCCTGGAGGGGAACAGAGTGAGAGAGATGTTTGGCTCTGGTACAGCCTGTGTTGTTTGCCCAGTTTCT GATATACTGTACAAAGGCGAGACAATACACATTCCAACTATGGAGAATGGTCCTAAGCTGGCAAGCCGCA TCTTGAGCAAATTAACTGATATCCAGTATGGAAGAGAAGAGAGCGACTGGACAATTGTGCTATCCTGA |
Restriction Sites | SgfI-MluI |
ACCN | NM_001178092 |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
Product Components | The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones. |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Reference Data | |
RefSeq | NM_001178092.1, NP_001171563.1 |
RefSeq Size | 9499 bp |
RefSeq ORF | 978 bp |
Locus ID | 586 |
Cytogenetics | 12p12.1 |
Protein Families | Druggable Genome |
Protein Pathways | Metabolic pathways, Pantothenate and CoA biosynthesis, Valine, leucine and isoleucine biosynthesis, Valine, leucine and isoleucine degradation |
Gene Summary | 'This gene encodes the cytosolic form of the enzyme branched-chain amino acid transaminase. This enzyme catalyzes the reversible transamination of branched-chain alpha-keto acids to branched-chain L-amino acids essential for cell growth. Two different clinical disorders have been attributed to a defect of branched-chain amino acid transamination: hypervalinemia and hyperleucine-isoleucinemia. As there is also a gene encoding a mitochondrial form of this enzyme, mutations in either gene may contribute to these disorders. Alternatively spliced transcript variants have been described. [provided by RefSeq, May 2010]' Transcript Variant: This variant (3) lacks two in-frame exons in the 5' coding region, compared to variant 1. This results in a shorter protein (isoform 3), compared to isoform 1. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments. |
Documents
Product Manuals |
FAQs |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC229891 | BCAT1 (Myc-DDK-tagged)-Human branched chain amino-acid transaminase 1, cytosolic (BCAT1), transcript variant 3 |
USD 420.00 |
|
RG229891 | BCAT1 (GFP-tagged) - Human branched chain amino-acid transaminase 1, cytosolic (BCAT1), transcript variant 3 |
USD 460.00 |
|
RC229891L3 | Lenti-ORF clone of BCAT1 (Myc-DDK-tagged)-Human branched chain amino-acid transaminase 1, cytosolic (BCAT1), transcript variant 3 |
USD 620.00 |
|
RC229891L4 | Lenti-ORF clone of BCAT1 (mGFP-tagged)-Human branched chain amino-acid transaminase 1, cytosolic (BCAT1), transcript variant 3 |
USD 620.00 |
{0} Product Review(s)
Be the first one to submit a review