ARL13B (NM_001174151) Human Untagged Clone

CAT#: SC328530

ARL13B (untagged)-Human ADP-ribosylation factor-like 13B (ARL13B) transcript variant 4


  "NM_001174151" in other vectors (4)

Reconstitution Protocol

USD 660.00

3 Weeks*

Size
    • 10 ug

Product Images

Other products for "ARL13B"

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Symbol ARL13B
Synonyms ARL2L1; JBTS8
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>NCBI ORF sequence for NM_001174151, the custom clone sequence may differ by one or more nucleotides


ATGGAAGAGACAAAAGAGGCTATGTCAGAAATGCTAAGACATCCTAGGATATCGGGAAAGCCTATATTGG
TGTTGGCAAATAAACAAGATAAAGAAGGAGCTTTAGGAGAAGCTGATGTCATTGAATGTCTATCTCTGGA
AAAATTGGTCAATGAGCACAAGTGCCTGTGTCAGATAGAACCATGTTCAGCAATCTCGGGGTATGGAAAG
AAAATTGACAAGTCCATTAAAAAAGGCCTTTATTGGCTGCTACATGTTATTGCAAGAGACTTTGATGCCT
TAAATGAACGCATCCAAAAAGAGACAACAGAGCAGCGTGCTCTTGAGGAACAAGAGAAACAAGAAAGAGC
TGAACGAGTGCGAAAATTACGAGAAGAAAGAAAACAAAATGAACAGGAGCAGGCTGAACTCGATGGAACC
AGTGGTCTGGCTGAGTTGGACCCAGAACCAACGAATCCTTTCCAGCCAATAGCATCTGTAATCATTGAGA
ATGAAGGAAAACTTGAAAGAGAGAAAAAAAACCAAAAAATGGAGAAAGACAGTGATGGCTGCCACCTGAA
ACATAAAATGGAGCATGAGCAAATAGAGACACAAGGCCAGGTTAATCACAATGGCCAAAAAAATAATGAA
TTTGGACTAGTAGAAAATTATAAGGAGGCATTAACACAGCAGTTAAAGAATGAAGATGAGACAGACCGGC
CATCATTGGAATCAGCTAATGGTAAAAAGAAAACTAAGAAACTAAGAATGAAAAGGAACCACCGGGTAGA
ACCACTTAATATAGATGACTGTGCTCCTGAGAGTCCAACGCCACCCCCACCCCCTCCTCCTGTTGGCTGG
GGAACCCCTAAAGTCACTAGACTTCCAAAACTTGAGCCTCTTGGTGAAACACATCATAATGATTTCTATA
GGAAGCCACTGCCTCCCCTGGCTGTGCCACAGCGACCTAACAGTGATGCTCATGATGTGATCTCATAA


Restriction Sites SgfI-MluI     
ACCN NM_001174151
ORF Size 978 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Reference Data
RefSeq NM_001174151.1, NP_001167622.1
RefSeq Size 3920
RefSeq ORF 978
Locus ID 200894
Gene Summary This gene encodes a member of the ADP-ribosylation factor-like family. The encoded protein is a small GTPase that contains both N-terminal and C-terminal guanine nucleotide-binding motifs. This protein is localized in the cilia and plays a role in cilia formation and in maintenance of cilia. Mutations in this gene are the cause of Joubert syndrome 8. Alternate splicing results in multiple transcript variants. [provided by RefSeq, Mar 2010]
Transcript Variant: This variant (4) differs in the 3' UTR, lacks an in-frame exon in the 5' coding region and uses a downstream start codon, compared to variant 1. The encoded isoform 3 has a shorter N-terminus, compared to isoform 1.

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.