Lactate Dehydrogenase B (LDHB) (NM_001174097) Human Untagged Clone
CAT#: SC328541
LDHB (untagged)-Human lactate dehydrogenase B (LDHB) transcript variant 2
"NM_001174097" in other vectors (4)
Product Images
![](https://cdn.origene.com/img/defaults-img-expression-plasmids.jpg)
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Symbol | LDHB |
Synonyms | HEL-S-281; LDH-B; LDH-H; LDHBD; TRG-5 |
Vector | pCMV6-Entry |
E. coli Selection | Kanamycin (25 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>NCBI ORF sequence for NM_001174097, the custom clone sequence may differ by one or more nucleotides
ATGGCAACTCTTAAGGAAAAACTCATTGCACCAGTTGCGGAAGAAGAGGCAACAGTTCCAAACAATAAGA TCACTGTAGTGGGTGTTGGACAAGTTGGTATGGCGTGTGCTATCAGCATTCTGGGAAAGTCTCTGGCTGA TGAACTTGCTCTTGTGGATGTTTTGGAAGATAAGCTTAAAGGAGAAATGATGGATCTGCAGCATGGGAGC TTATTTCTTCAGACACCTAAAATTGTGGCAGATAAAGATTATTCTGTGACCGCCAATTCTAAGATTGTAG TGGTAACTGCAGGAGTCCGTCAGCAAGAAGGGGAGAGTCGGCTCAATCTGGTGCAGAGAAATGTTAATGT CTTCAAATTCATTATTCCTCAGATCGTCAAGTACAGTCCTGATTGCATCATAATTGTGGTTTCCAACCCA GTGGACATTCTTACGTATGTTACCTGGAAACTAAGTGGATTACCCAAACACCGCGTGATTGGAAGTGGAT GTAATCTGGATTCTGCTAGATTTCGCTACCTTATGGCTGAAAAACTTGGCATTCATCCCAGCAGCTGCCA TGGATGGATTTTGGGGGAACATGGCGACTCAAGTGTGGCTGTGTGGAGTGGTGTGAATGTGGCAGGTGTT TCTCTCCAGGAATTGAATCCAGAAATGGGAACTGACAATGATAGTGAAAATTGGAAGGAAGTGCATAAGA TGGTGGTTGAAAGTGCCTATGAAGTCATCAAGCTAAAAGGATATACCAACTGGGCTATTGGATTAAGTGT GGCTGATCTTATTGAATCCATGTTGAAAAATCTATCCAGGATTCATCCCGTGTCAACAATGGTAAAGGGG ATGTATGGCATTGAGAATGAAGTCTTCCTGAGCCTTCCATGTATCCTCAATGCCCGGGGATTAACCAGCG TTATCAACCAGAAGCTAAAGGATGATGAGGTTGCTCAGCTCAAGAAAAGTGCAGATACCCTGTGGGACAT CCAGAAGGACCTAAAAGACCTGTGA |
Restriction Sites | SgfI-MluI |
ACCN | NM_001174097 |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
Product Components | The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones. |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Reference Data | |
RefSeq | NM_001174097.2, NP_001167568.1 |
RefSeq Size | 1558 bp |
RefSeq ORF | 1005 bp |
Locus ID | 3945 |
Cytogenetics | 12p12.1 |
Protein Families | Druggable Genome |
Protein Pathways | Cysteine and methionine metabolism, Glycolysis / Gluconeogenesis, Metabolic pathways, Propanoate metabolism, Pyruvate metabolism |
Gene Summary | 'This gene encodes the B subunit of lactate dehydrogenase enzyme, which catalyzes the interconversion of pyruvate and lactate with concomitant interconversion of NADH and NAD+ in a post-glycolysis process. Alternatively spliced transcript variants have been found for this gene. Recent studies have shown that a C-terminally extended isoform is produced by use of an alternative in-frame translation termination codon via a stop codon readthrough mechanism, and that this isoform is localized in the peroxisomes. Mutations in this gene are associated with lactate dehydrogenase B deficiency. Pseudogenes have been identified on chromosomes X, 5 and 13. [provided by RefSeq, Feb 2016]' Transcript Variant: This variant (2) differs in the 5' UTR compared to variant 1. Variants 1 and 2 encode the same isoform (LDHB). |
Documents
Product Manuals |
FAQs |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC229903 | LDHB (Myc-DDK-tagged)-Human lactate dehydrogenase B (LDHB), transcript variant 2 |
USD 420.00 |
|
RG229903 | LDHB (GFP-tagged) - Human lactate dehydrogenase B (LDHB), transcript variant 2 |
USD 460.00 |
|
RC229903L3 | Lenti-ORF clone of LDHB (Myc-DDK-tagged)-Human lactate dehydrogenase B (LDHB), transcript variant 2 |
USD 620.00 |
|
RC229903L4 | Lenti-ORF clone of LDHB (mGFP-tagged)-Human lactate dehydrogenase B (LDHB), transcript variant 2 |
USD 620.00 |
{0} Product Review(s)
Be the first one to submit a review