AGA (NM_001171988) Human Untagged Clone

CAT#: SC328542

AGA (untagged)-Human aspartylglucosaminidase (AGA) transcript variant 2

Specifications

Product Data

• Type: Human Untagged Clone
• Tag: Tag Free
• Symbol: AGA
• Synonyms: AGU; ASRG; GA
• Vector: pCMV6-Entry
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Sequence Data:
  Fully Sequenced ORF

  >OriGene SC328542 ORF sequence for NM_001171988, the custom clone sequence may differ by one or more nucleotides
  
  
  ATGGCGCGGAAGTCGAACTTGCCTGTGCTTCTCGTGCCGTTTCTGCTCTGCCAGGCCCTAGTGCGCTGCT
  CCAGCCCTCTGCCCCTGGTCGTCAACACTTGGCCCTTTAAGAATGCAACCGAAGCAGCGTGGAGGGCATT
  AGCATCTGGAGGCTCTGCCCTGGATGCAGTGGAGAGCGGCTGTGCCATGTGTGAGAGAGAGCAGTGTGAC
  GGCTCTGTAGGCTTTGGAGGAAGTCCTGATGAACTTGGAGAAACCACACTAGATGCCATGATCATGGATG
  GCACTACTATGGATGTAGGAGCAGTAGGAGATCTCAGACGAATTAAAAATGCTATTGGTGTGGCACGGAA
  AGTACTGGAACATACAACACACACACTTTTAGTAGGAGAGTCAGCCACCACATTTGCTCAAAGTATGGGG
  TTTATCAATGAAGACTTATCTACCACTGCTTCTCAAGCTCTTCATTCAGATTGGCTTGCTCGGAATTGCC
  AGCCAAATTATTGGAGGAATGTTATACCAGATCCCTCAAAATACTGCGGACCCTACAAACCACCTGGTAT
  CTTAAAGCAGGATATTCCTATCCATAAAGAAACAGAAGATGATCGTGGTCATGACACTATTGGCATGGTT
  GTAATCCATAAGACAGGACATATTGCTGCTGGTACATCTACAAATGGAGACTCACCAATACCTGGAGCTG
  GAGCCTATGCTGACGATACTGCAGGGGCAGCCGCAGCCACTGGGAATGGTGATATATTGATGCGCTTCCT
  GCCAAGCTACCAAGCTGTAGAATACATGAGAAGAGGAGAAGATCCAACCATAGCTTGCCAAAAAGTGATT
  TCAAGAATCCAGAAGCATTTTCCAGAATTCTTTGGGGCTGTTATATGTGCCAATGTGACTGGAAGTTACG
  GTGCTGCTTGCAATAAACTTTCAACATTTACTCAGTTTAGTTTCATGGTTTATAATTCCGAAAAAAATCA
  GCCAACTGAGGAAAAAGTGGACTGCATCTAA
  
  
• Restriction Sites: SgfI-MluI
• ACCN: NM_001171988
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
• OTI Annotation: This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA
• Product Components: The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones.
• Reconstitution: 1. Centrifuge at 5,000xg for 5min.
  2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
  3. Close the tube and incubate for 10 minutes at room temperature.
  4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
  5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.

Reference Data

• RefSeq: NM_001171988.1, NP_001165459.1
• RefSeq Size: 2083 bp
• RefSeq ORF: 1011 bp
• Locus ID: 175
• Cytogenetics: 4q34.3
• Protein Families: Druggable Genome, Protease
• Protein Pathways: Lysosome, Other glycan degradation
• Gene Summary: 'This gene encodes a member of the N-terminal nucleophile (Ntn) hydrolase family of proteins. The encoded preproprotein is proteolytically processed to generate alpha and beta chains that comprise the mature enzyme. This enzyme is involved in the catabolism of N-linked oligosaccharides of glycoproteins. It cleaves asparagine from N-acetylglucosamines as one of the final steps in the lysosomal breakdown of glycoproteins. Mutations in this gene are associated with the lysosomal storage disease aspartylglycosaminuria that results in progressive neurodegeneration. Alternative splicing results in multiple transcript variants, at least one of which encodes an isoform that is subject to proteolytic processing. [provided by RefSeq, Nov 2015]'
  Transcript Variant: This variant (2) uses two alternate in-frame splice sites in the central coding region compared to variant 1. This results in a shorter protein (isoform 2), compared to isoform 1. This isoform (2) may undergo proteolytic processing similar to isoform 1.