CCM2 (NM_001167935) Human Untagged Clone

CAT#: SC328565

CCM2 (untagged)-Human cerebral cavernous malformation 2 (CCM2) transcript variant 4


  "NM_001167935" in other vectors (4)

Reconstitution Protocol

USD 600.00

3 Weeks*

Size
    • 10 ug

Product Images

Other products for "CCM2"

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Symbol CCM2
Synonyms C7orf22; OSM; PP10187
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>NCBI ORF sequence for NM_001167935, the custom clone sequence may differ by one or more nucleotides


ATGGAAGAGGAGGGCAAGAAGGGCAAGAAGCCTGGAATTGTCTCGCCATTTAAACGAGTATTCCTAAAAG
GTGAAAAGAGTAGAGATAAGAAAGCCCATGAGAAGGTGACAGAGAGGCGCCCTCTGCACACTGTGGTGTT
GTCATTGCCTGAGCGCGTCGAGCCAGACAGACTGCTGAGCGACTATATTGAGAAGGAGGTAAAGTATTTA
GGTCAGTTAACGTCCATACCAGGATACCTGAATCCCTCCAGTAGGACTGAAATCCTGCATTTCATAGACA
ATGCAAAGAGAGCCCACCAGCTTCCGGGACACTTGACTCAGGAGCACGATGCTGTGCTCAGCCTGTCTGC
GTACAACGTCAAGCTGGCCTGGAGGGACGGGGAGGATATCATCCTCAGGGTGCCCATCCATGACATCGCC
GCCGTCTCCTATGTTCGGGATGACGCTGCACACCTGGTGGTCCTGAAGACAGATGACTCTTCTACAAAAG
TGGACATTAAGGAGACCTACGAGGTGGAAGCCAGCACTTTCTGCTTCCCTGAATCTGTGGATGTGGGTGG
TGCATCACCCCACAGCAAGACCATCAGTGAGAGCGAGCTGAGCGCCAGCGCCACTGAGCTGCTGCAGGAC
TACATGCTGACGCTGCGCACCAAGCTGTCATCACAGGAGATCCAGCAGTTTGCAGCACTGCTGCACGAGT
ACCGCAATGGGGCCTCTATCCACGAGTTCTGCATCAACCTGCGGCAGCTCTACGGGGACAGCCGCAAGTT
CCTGCTGCTTGGTCTGAGGCCCTTCATCCCTGAGAAGGACAGCCAGCACTTCGAGAACTTCCTGGAGACC
ATTGGCGTGAAGGATGGCCGCGGCATCATCACTGACAGCTTTGGCAGGCACCGGCGGGCCCTGAGCACCA
CATCCAGTTCCACCACCAATGGGAACAGGGCCACGGGCAGCTCTGATGACCGGTCGGCACCCTCAGAGGG
GGATGAGTGGGACCGCATGATCTCGGACATCAGCAGCGACATTGAGGCGCTGGGCTGCAGCATGGACCAG
GACTCAGCATGA


Restriction Sites SgfI-MluI     
ACCN NM_001167935
ORF Size 1062 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Reference Data
RefSeq NM_001167935.1, NP_001161407.1
RefSeq Size 1631
RefSeq ORF 1062
Locus ID 83605
Gene Summary This gene encodes a scaffold protein that functions in the stress-activated p38 Mitogen-activated protein kinase (MAPK) signaling cascade. The protein interacts with SMAD specific E3 ubiquitin protein ligase 1 (also known as SMURF1) via a phosphotyrosine binding domain to promote RhoA degradation. The protein is required for normal cytoskeletal structure, cell-cell interactions, and lumen formation in endothelial cells. Mutations in this gene result in cerebral cavernous malformations. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Nov 2009]
Transcript Variant: This variant (4) represents use of an alternate promoter and 5' UTR, uses a distinct start codon, and lacks two alternate in-frame exons in the central coding region, compared to variant 1. The resulting isoform (4) has a shorter and distinct N-terminus and lacks an internal segment, compared to isoform 1.

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.