CX3CR1 (NM_001171171) Human Untagged Clone

CAT#: SC328568

CX3CR1 (untagged)-Human chemokine (C-X3-C motif) receptor 1 (CX3CR1) transcript variant 2

Specifications

Product Data

• Type: Human Untagged Clone
• Tag: Tag Free
• Symbol: CX3CR1
• Synonyms: CCRL1; CMKBRL1; CMKDR1; GPR13; GPRV28; V28
• Vector: pCMV6-Entry
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Sequence Data:
  Fully Sequenced ORF

  >NCBI ORF sequence for NM_001171171, the custom clone sequence may differ by one or more nucleotides
  
  
  ATGGATCAGTTCCCTGAATCAGTGACAGAAAACTTTGAGTACGATGATTTGGCTGAGGCCTGTTATATTG
  GGGACATCGTGGTCTTTGGGACTGTGTTCCTGTCCATATTCTACTCCGTCATCTTTGCCATTGGCCTGGT
  GGGAAATTTGTTGGTAGTGTTTGCCCTCACCAACAGCAAGAAGCCCAAGAGTGTCACCGACATTTACCTC
  CTGAACCTGGCCTTGTCTGATCTGCTGTTTGTAGCCACTTTGCCCTTCTGGACTCACTATTTGATAAATG
  AAAAGGGCCTCCACAATGCCATGTGCAAATTCACTACCGCCTTCTTCTTCATCGGCTTTTTTGGAAGCAT
  ATTCTTCATCACCGTCATCAGCATTGATAGGTACCTGGCCATCGTCCTGGCCGCCAACTCCATGAACAAC
  CGGACCGTGCAGCATGGCGTCACCATCAGCCTAGGCGTCTGGGCAGCAGCCATTTTGGTGGCAGCACCCC
  AGTTCATGTTCACAAAGCAGAAAGAAAATGAATGCCTTGGTGACTACCCCGAGGTCCTCCAGGAAATCTG
  GCCCGTGCTCCGCAATGTGGAAACAAATTTTCTTGGCTTCCTACTCCCCCTGCTCATTATGAGTTATTGC
  TACTTCAGAATCATCCAGACGCTGTTTTCCTGCAAGAACCACAAGAAAGCCAAAGCCATTAAACTGATCC
  TTCTGGTGGTCATCGTGTTTTTCCTCTTCTGGACACCCTACAACGTTATGATTTTCCTGGAGACGCTTAA
  GCTCTATGACTTCTTTCCCAGTTGTGACATGAGGAAGGATCTGAGGCTGGCCCTCAGTGTGACTGAGACG
  GTTGCATTTAGCCATTGTTGCCTGAATCCTCTCATCTATGCATTTGCTGGGGAGAAGTTCAGAAGATACC
  TTTACCACCTGTATGGGAAATGCCTGGCTGTCCTGTGTGGGCGCTCAGTCCACGTTGATTTCTCCTCATC
  TGAATCACAAAGGAGCAGGCATGGAAGTGTTCTGAGCAGCAATTTTACTTACCACACGAGTGATGGAGAT
  GCATTGCTCCTTCTCTGA
  
  
• Restriction Sites: SgfI-MluI
• ACCN: NM_001171171
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
• OTI Annotation: This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
• Product Components: The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones.
• Reconstitution: 1. Centrifuge at 5,000xg for 5min.
  2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
  3. Close the tube and incubate for 10 minutes at room temperature.
  4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
  5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.

Reference Data

• RefSeq: NM_001171171.1, NP_001164642.1
• RefSeq Size: 3264 bp
• RefSeq ORF: 1068 bp
• Locus ID: 1524
• Cytogenetics: 3p22.2
• Protein Families: Druggable Genome, GPCR, Transmembrane
• Protein Pathways: Chemokine signaling pathway, Cytokine-cytokine receptor interaction
• Gene Summary: 'Fractalkine is a transmembrane protein and chemokine involved in the adhesion and migration of leukocytes. The protein encoded by this gene is a receptor for fractalkine. The encoded protein also is a coreceptor for HIV-1, and some variations in this gene lead to increased susceptibility to HIV-1 infection and rapid progression to AIDS. Four transcript variants encoding two different isoforms have been found for this gene. [provided by RefSeq, Jan 2010]'
  Transcript Variant: This variant (2) differs in the 5' UTR and coding sequence compared to variant 1. The resulting isoform (b) is shorter at the N-terminus compared to isoform a. Variants 2, 3, and 4 all encode the same isoform.