IL1RAP (NM_001167930) Human Untagged Clone

CAT#: SC328571

IL1RAP (untagged)-Human interleukin 1 receptor accessory protein (IL1RAP) transcript variant 5


  "NM_001167930" in other vectors (4)

Reconstitution Protocol

USD 610.00

3 Weeks*

Size
    • 10 ug

Product Images

Other products for "IL1RAP"

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Symbol IL1RAP
Synonyms C3orf13; IL-1RAcP; IL1R3
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>NCBI ORF sequence for NM_001167930, the custom clone sequence may differ by one or more nucleotides


ATGACACTTCTGTGGTGTGTAGTGAGTCTCTACTTTTATGGAATCCTGCAAAGTGATGCCTCAGAACGCT
GCGATGACTGGGGACTAGACACCATGAGGCAAATCCAAGTGTTTGAAGATGAGCCAGCTCGCATCAAGTG
CCCACTCTTTGAACACTTCTTGAAATTCAACTACAGCACAGCCCATTCAGCTGGCCTTACTCTGATCTGG
TATTGGACTAGGCAGGACCGGGACCTTGAGGAGCCAATTAACTTCCGCCTCCCCGAGAACCGCATTAGTA
AGGAGAAAGATGTGCTGTGGTTCCGGCCCACTCTCCTCAATGACACTGGCAACTATACCTGCATGTTAAG
GAACACTACATATTGCAGCAAAGTTGCATTTCCCTTGGAAGTTGTTCAAAAAGACAGCTGTTTCAATTCC
CCCATGAAACTCCCAGTGCATAAACTGTATATAGAATATGGCATTCAGAGGATCACTTGTCCAAATGTAG
ATGGATATTTTCCTTCCAGTGTCAAACCGACTATCACTTGGTATATGGGCTGTTATAAAATACAGAATTT
TAATAATGTAATACCCGAAGGTATGAACTTGAGTTTCCTCATTGCCTTAATTTCAAATAATGGAAATTAC
ACATGTGTTGTTACATATCCAGAAAATGGACGTACGTTTCATCTCACCAGGACTCTGACTGTAAAGGTAG
TAGGCTCTCCAAAAAATGCAGTGCCCCCTGTGATCCATTCACCTAATGATCATGTGGTCTATGAGAAAGA
ACCAGGAGAGGAGCTACTCATTCCCTGTACGGTCTATTTTAGTTTTCTGATGGATTCTCGCAATGAGGTT
TGGTGGACCATTGATGGAAAAAAACCTGATGACATCACTATTGATGTCACCATTAACGAAAGTATAAGTC
ATAGTAGAACAGAAGATGAAACAAGAACTCAGATTTTGAGCATCAAGAAAGTTACCTCTGAGGATCTCAA
GCGCAGCTATGTCTGTCATGCTAGAAGTGCCAAAGGCGAAGTTGCCAAAGCAGCCAAGGTGAAGCAGAAA
GGTAATAGATGCGGTCAGTGA


Restriction Sites SgfI-MluI     
ACCN NM_001167930
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Product Components The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones.
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_001167930.1, NP_001161402.1
RefSeq Size 2027 bp
RefSeq ORF 1071 bp
Locus ID 3556
Cytogenetics 3q28
Protein Families Druggable Genome, Secreted Protein, Transmembrane
Protein Pathways Apoptosis, Cytokine-cytokine receptor interaction
Gene Summary 'This gene encodes a component of the interleukin 1 receptor complex, which initiates signalling events that result in the activation of interleukin 1-responsive genes. Alternative splicing of this gene results in membrane-bound and soluble isoforms differing in their C-terminus. The ratio of soluble to membrane-bound forms increases during acute-phase induction or stress. [provided by RefSeq, Jul 2018]'
Transcript Variant: This variant (5) has multiple differences, compared to variant 1. It encodes the soluble isoform (2). Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments.

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.