SSH3BP1 (ABI1) (NM_001178124) Human Untagged Clone

CAT#: SC328617

ABI1 (untagged)-Human abl-interactor 1 (ABI1) transcript variant 11


  "NM_001178124" in other vectors (4)

Reconstitution Protocol

USD 660.00

4 Weeks*

Size
    • 10 ug

Product Images

Other products for "ABI1"

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Symbol ABI1
Synonyms ABI-1; ABLBP4; E3B1; NAP1BP; SSH3BP; SSH3BP1
Vector pCMV6-XL5
E. coli Selection Ampicillin (100 ug/mL)
Mammalian Cell Selection None
Sequence Data
>NCBI ORF sequence for NM_001178124, the custom clone sequence may differ by one or more nucleotides
ATGGCAGAGCTGCAGATGTTACTAGAGGAGGAGATCCCGTCTGGCAAGAGGGCGCTGATC
GAGAGTTACCAGAACCTGACTCGGGTGGCAGACTACTGTGAAAACAACTACATACAGGCT
ACAGACAAGAGAAAAGCTTTAGAGGAGACCAAAGCCTATACAACCCAATCTCTAGCTAGT
GTTGCTTATCAAATAAATGCATTGGCCAACAATGTACTCCAGTTGCTGGATATCCAAGCC
TCTCAGCTTCGGAGAATGGAGTCTTCCATCAATCATATCTCACAGACTGTGGATATTCAT
AAGGAGAAAGTGGCACGAAGAGAGATTGGTATTTTGACAACAAATAAGAATACATCAAGA
ACTCACAAAATAATAGCACCTGCGAATATGGAGCGCCCTGTAAGGTATATTCGGAAACCT
ATCGATTACACAGTTCTGGATGATGTGGGCCATGGTGTCAAGCATGGAAATAACCAGCCT
GCAAGAACTGGCACACTGTCGAGAACAAATCCTCCTACTCAGAAACCGCCAAGTCCTCCC
ATGTCAGGCCGGGGAACACTGGGACGGAATACTCCTTATAAAACCCTGGAACCTGTTAAA
CCCCCAACAGTTCCTAATGACTATATGACCAGTCCTGCTAGGCTTGGAAGTCAGCATAGT
CCAGGCAGGACAGCATCTTTAAATCAGAGACCAAGGACACACAGTGGAAGTAGTGGAGGA
AGTGGAAGTCGAGAAAACAGTGGTAGCAGTAGTATTGGCATTCCCATTGCTGTGCCTACA
CCTTCGCCACCCACTATTGGACCAGTTGCTGATAGTCCAACTCCACCGCCACCACCTCCA
CCAGATGACATTCCCATGTTTGATGACTCTCCACCTCCCCCACCACCACCACCAGTGGAT
TATGAAGATGAGGAGGCTGCAGTAGTTCAGTATAATGATCCATATGCAGATGGGGATCCT
GCTTGGGCCCCCAAGAATTATATTGAGAAAGTTGTTGCAATATATGATTATACAAAAGAC
AAGGATGATGAGCTGTCATTTATGGAGGGTGCAATCATTTATGTTATAAAGAAGAATGAT
GATGGCTGGTATGAAGGAGTCTGCAATCGAGTGACTGGTCTGTTCCCTGGGAACTATGTT
GAATCAATCATGCACTATACTGATTAA
Restriction Sites Please inquire     
ACCN NM_001178124
ORF Size 1167 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Reference Data
RefSeq NM_001178124.1, NP_001171595.1
RefSeq Size 3365
RefSeq ORF 1167
Locus ID 10006
Gene Summary This gene encodes a member of the Abelson-interactor family of adaptor proteins. These proteins facilitate signal transduction as components of several multiprotein complexes, and regulate actin polymerization and cytoskeletal remodeling through interactions with Abelson tyrosine kinases. The encoded protein plays a role in macropinocytosis as a component of the WAVE2 complex, and also forms a complex with EPS8 and SOS1 that mediates signal transduction from Ras to Rac. This gene may play a role in the progression of several malignancies including melanoma, colon cancer and breast cancer, and a t(10;11) chromosomal translocation involving this gene and the MLL gene has been associated with acute myeloid leukemia. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene, and a pseudogene of this gene is located on the long arm of chromosome 14. [provided by RefSeq, Sep 2011]
Transcript Variant: This variant (11) lacks three alternate in-frame coding exons, compared to variant 1. The resulting protein (isoform k) has the same N- and C-termini but is shorter when it is compared to isoform a. This isoform has also been called 'variant 72'. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments.

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.