TCN2 (NM_001184726) Human Untagged Clone
CAT#: SC328641
TCN2 (untagged)-Human transcobalamin II (TCN2) transcript variant 2
"NM_001184726" in other vectors (6)
Product Images
![](https://cdn.origene.com/img/defaults-img-expression-plasmids.jpg)
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Symbol | TCN2 |
Synonyms | D22S676; D22S750; II; TC; TC-2; TC2; TC II; TCII |
Vector | pCMV6-Entry |
E. coli Selection | Kanamycin (25 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>NCBI ORF sequence for NM_001184726, the custom clone sequence may differ by one or more nucleotides
ATGAGGCACCTTGGGGCCTTCCTCTTCCTTCTGGGGGTCCTGGGGGCCCTCACTGAGATGTGTGAAATAC CAGAGATGGACAGCCATCTGGTAGAGAAGTTGGGCCAGCACCTCTTACCTTGGATGGACCGGCTTTCCCT GGAGCACTTGAACCCCAGCATCTATGTGGGCCTACGCCTCTCCAGTCTGCAGGCTGGGACCAAGGAAGAC CTCTACCTGCACAGCCTCAAGCTTGGTTACCAGCAGTGCCTCCTAGGGTCTGCCTTCAGCGAGGATGACG GTGACTGCCAGGGCAAGCCTTCCATGGGCCAGCTGGCCCTCTACCTGCTCGCTCTCAGAGCCAACTGGCA TGATCACAAGGGCCACCCCCACACTAGCTACTACCAGTATGGCCTGGGCATTCTGGCCCTGTGTCTCCAC CAGAAGCGGGTCCATGACAGCGTGGTGGACAAACTTCTGTATGCTGTGGAACCTTTCCACCAGGGCCACC ATTCTGTGGACACAGCAGCCATGGCAGGCTTGGCATTCACCTGTCTGAAGCGCTCAAACTTCAACCCTGG TCGGAGACAACGGATCACCATGGCCATCAGAACAGTGCGAGAGGAGATCTTGAAGGCCCAGACCCCCGAG GGCCACTTTGGGAATGTCTACAGCACCCCATTGGCATTACAGTTCCTCATGACTTCCCCCATGCGTGGGG CAGAACTGGGAACAGCATGTCTCAAGGCGAGGGTTGCTTTGCTGGCCAGTCTGCAGGATGGAGCCTTCCA GAATGCTCTCATGATTTCCCAGCTGCTGCCCGTTCTGAACCACAAGACCTACATTGATCTGATCTTCCCA GACTGTCTGGCACCACGAGTCATGTTGGAACCAGCTGCTGAGACCATTCCTCAGACCCAAGAGATCATCA GTGTCACGCTGCAGGTGCTTAGTCTCTTGCCGCCGTACAGACAGTCCATCTCTGTTCTGGCCGGGTCCAC CGTGGAAGATGTCCTGAAGAAGGCCCATGAGTTAGGAGGATTCACATATGAAACACAGGCCTCCTTGTCA GGCCCCTACTTAACCTCCGTGATGGGGAAAGCGGCCGGAGAAAGGGAGTTCTGGCAGCTTCTCCGAGACC CCAACACCCCACTGTTGCAAGGTATTGCTGACTACAGACCCAAGGATGGAGAAACCATTGAGCTGAGGCT GGTTAGCTGGTAG |
Restriction Sites | SgfI-MluI |
ACCN | NM_001184726 |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
Product Components | The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones. |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Reference Data | |
RefSeq | NM_001184726.1, NP_001171655.1 |
RefSeq Size | 2006 bp |
RefSeq ORF | 1203 bp |
Locus ID | 6948 |
Cytogenetics | 22q12.2 |
Protein Families | Druggable Genome, Secreted Protein |
Gene Summary | 'This gene encodes a member of the vitamin B12-binding protein family. This family of proteins, alternatively referred to as R binders, is expressed in various tissues and secretions. This plasma protein binds cobalamin and mediates the transport of cobalamin into cells. This protein and other mammalian cobalamin-binding proteins, such as transcobalamin I and gastric intrisic factor, may have evolved by duplication of a common ancestral gene. Alternative splicing results in multiple transcript variants.[provided by RefSeq, May 2010]' Transcript Variant: This variant (2) uses an alternate in-frame splice site in the 5' coding region, compared to variant 1. This results in a shorter protein (isoform 2), compared to isoform 1. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments. |
Documents
Product Manuals |
FAQs |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC230003 | TCN2 (Myc-DDK-tagged)-Human transcobalamin II (TCN2), transcript variant 2 |
USD 420.00 |
|
RG230003 | TCN2 (GFP-tagged) - Human transcobalamin II (TCN2), transcript variant 2 |
USD 460.00 |
|
RC230003L1 | Lenti ORF clone of Human transcobalamin II (TCN2), transcript variant 2, Myc-DDK-tagged |
USD 768.00 |
|
RC230003L2 | Lenti ORF clone of Human transcobalamin II (TCN2), transcript variant 2, mGFP tagged |
USD 620.00 |
|
RC230003L3 | Lenti ORF clone of Human transcobalamin II (TCN2), transcript variant 2, Myc-DDK-tagged |
USD 620.00 |
|
RC230003L4 | Lenti ORF clone of Human transcobalamin II (TCN2), transcript variant 2, mGFP tagged |
USD 620.00 |
{0} Product Review(s)
Be the first one to submit a review