LMX1B (NM_001174147) Human Untagged Clone

CAT#: SC328645

LMX1B (untagged)-Human LIM homeobox transcription factor 1 beta (LMX1B) transcript variant 2


  "NM_001174147" in other vectors (4)

Reconstitution Protocol

USD 680.00

3 Weeks*

Size
    • 10 ug

Product Images

Other products for "LMX1B"

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Symbol LMX1B
Synonyms LMX1.2; NPS1
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>NCBI ORF sequence for NM_001174147, the custom clone sequence may differ by one or more nucleotides


ATGGATATAGCAACAGGTCCCGAGTCGCTGGAGAGGTGCTTCCCTCGCGGGCAGACGGACTGCGCCAAGA
TGTTGGACGGCATCAAGATGGAGGAGCACGCCCTGCGCCCCGGGCCCGCCACTCTGGGGGTGCTGCTGGG
CTCCGACTGCCCGCATCCCGCCGTCTGCGAGGGCTGCCAGCGGCCCATCTCCGACCGCTTCCTGATGCGA
GTCAACGAGTCGTCCTGGCACGAGGAGTGTTTGCAGTGCGCGGCGTGTCAGCAAGCCCTCACCACCAGCT
GCTACTTCCGGGATCGGAAACTGTACTGCAAACAAGACTACCAACAGCTCTTCGCGGCCAAGTGCAGCGG
CTGCATGGAGAAGATCGCCCCCACCGAGTTCGTGATGCGGGCGCTGGAGTGCGTGTACCACCTGGGCTGC
TTCTGCTGCTGCGTGTGTGAACGGCAGCTACGCAAGGGCGACGAATTCGTGCTCAAGGAGGGCCAGCTGC
TGTGCAAGGGTGACTACGAGAAGGAGAAGGACCTGCTCAGCTCCGTGAGCCCCGACGAGTCCGACTCCGT
GAAGAGCGAGGATGAAGATGGGGACATGAAGCCGGCCAAGGGGCAGGGCAGTCAGAGCAAGGGCAGCGGG
GATGACGGGAAGGACCCGCGGAGGCCCAAGCGACCCCGGACCATCCTCACCACGCAGCAGCGAAGAGCCT
TCAAGGCCTCCTTCGAGGTCTCGTCGAAGCCTTGCCGAAAGGTCCGAGAGACACTGGCAGCTGAGACGGG
CCTCAGTGTGCGCGTGGTCCAGGTCTGGTTTCAGAACCAAAGAGCAAAGATGAAGAAGCTGGCGCGGCGG
CACCAGCAGCAGCAGGAGCAGCAGAACTCCCAGCGGCTGGGCCAGGAGGTCCTGTCCAGCCGCATGGAGG
GCATGATGGCTTCCTACACGCCGCTGGCCCCACCACAGCAGCAGATCGTGGCCATGGAACAGAGCCCCTA
CGGCAGCAGCGACCCCTTCCAGCAGGGCCTCACGCCGCCCCAAATGCCAGGTGACCACATGAACCCCTAT
GGGAACGACTCCATCTTCCATGACATCGACAGCGATACCTCCTTAACCAGCCTCAGCGACTGCTTCCTCG
GCTCCTCAGACGTGGGCTCCCTGCAGGCCCGCGTGGGGAACCCCATCGACCGGCTCTACTCCATGCAGAG
TTCCTACTTCGCCTCCTGA


Restriction Sites SgfI-MluI     
ACCN NM_001174147
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Product Components The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones.
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_001174147.1, NP_001167618.1
RefSeq Size 5804 bp
RefSeq ORF 1209 bp
Locus ID 4010
Cytogenetics 9q33.3
Protein Families Transcription Factors
Gene Summary 'This gene encodes a member of LIM-homeodomain family of proteins containing two N-terminal zinc-binding LIM domains, 1 homeodomain, and a C-terminal glutamine-rich domain. It functions as a transcription factor, and is essential for the normal development of dorsal limb structures, the glomerular basement membrane, the anterior segment of the eye, and dopaminergic and serotonergic neurons. Mutations in this gene are associated with nail-patella syndrome. Alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Mar 2010]'
Transcript Variant: This variant (2) uses an alternate donor splice site at the penultimate coding exon compared to variant 1, resulting in a longer isoform (2) containing an additional 7 aa protein segment compared to isoform 1. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments.

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.