RBMS3 (NM_001177711) Human Untagged Clone

CAT#: SC328691

RBMS3 (untagged)-Human RNA binding motif single stranded interacting protein 3 (RBMS3) transcript variant 5


  "NM_001177711" in other vectors (4)

Reconstitution Protocol

USD 710.00

3 Weeks*

Size
    • 10 ug

Product Images

Other products for "RBMS3"

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Symbol RBMS3
Synonyms FLJ36544
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>NCBI ORF sequence for NM_001177711, the custom clone sequence may differ by one or more nucleotides


ATGGGCAAACGCCTGGATCAGCCACAAATGTACCCCCAGTACACTTACTACTATCCTCATTATCTCCAAA
CCAAGCAGTCCTATGCACCAGCTCCCCACCCCATGGCTCCTCCCAGCCCCAGCACAAACAGCAGCAGCAA
CAACAGCAGCAACAACAGCAGCGGGGAACAGTTGAGTAAAACCAACCTGTACATTCGAGGCCTCCCACCA
GGCACCACTGACCAGGACCTAATCAAGCTGTGCCAACCGTATGGAAAAATTGTATCTACAAAGGCAATTC
TTGACAAAAACACAAATCAGTGCAAAGGTTATGGTTTTGTAGATTTTGACAGTCCTGCAGCCGCACAGAA
AGCGGTAGCATCTCTCAAGGCAAATGGCGTGCAGGCACAGATGGCTAAGCAACAAGAGCAAGACCCAACA
AACCTATACATCTCAAATCTCCCCATTTCTATGGATGAGCAGGAGCTTGAGAATATGCTGAAACCCTTTG
GACATGTCATTTCCACAAGAATACTAAGAGACGCTAATGGAGTCAGCAGAGGTGTTGGCTTTGCCAGAAT
GGAGTCTACTGAAAAATGTGAAGTGGTAATTCAACATTTTAATGGAAAATATCTGAAAACACCACCAGGC
ATCCCAGCCCCCAGTGAGCCTTTGCTGTGCAAATTCGCTGATGGAGGACAAAAGAAGCGACAGAATCAAA
GCAAATATACCCAGAATGGGAGGCCTTGGCCCAGGGAAGGAGAGGCTGGCATGGCTTTGACCTATGACCC
CACAGCTGCCATACAGAATGGATTTTATTCTTCACCGTACAGTATTGCAACCAACCGCATGATTCCACAG
ACATCTATCACGCCATTCATTGCTGCTTCCCCTGTCTCCACATACCAGGTCCAGAGTACTTCATGGATGC
CTCATCCGCCATACGTTATGCAACCAACAGGTGCTGTGATTACACCAACCATGGACCATCCCATGTCAAT
GCAGCCAGCCAACATGATGGGCCCACTGACACAGCAGATGAATCACCTTTCGTTGGGCACAACAGGAACG
TATATGACTGCTGCTGCTCCTATGCAAGGGACCTACATTCCTCAGTACACGCCTGTGCCTCCGACAGCTG
TTTCTATTGAAGGTGTTGTTGCTGATACCTCTCCCCAGACAGTGGCACCTTCATCCCAGGACACCAGTGG
TCAGCAGCAACAGATAGCAGTGGACACATCCAACGAACATGCACCTGCATATTCTTACCAACAGTCTAAA
CCATAA


Restriction Sites SgfI-MluI     
ACCN NM_001177711
ORF Size 1266 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Reference Data
RefSeq NM_001177711.1, NP_001171182.1
RefSeq Size 8186
RefSeq ORF 1266
Locus ID 27303
Gene Summary This gene encodes an RNA-binding protein that belongs to the c-myc gene single-strand binding protein family. These proteins are characterized by the presence of two sets of ribonucleoprotein consensus sequence (RNP-CS) that contain conserved motifs, RNP1 and RNP2, originally described in RNA binding proteins, and required for DNA binding. These proteins have been implicated in such diverse functions as DNA replication, gene transcription, cell cycle progression and apoptosis. The encoded protein was isolated by virtue of its binding to an upstream element of the alpha2(I) collagen promoter. The observation that this protein localizes mostly in the cytoplasm suggests that it may be involved in a cytoplasmic function such as controlling RNA metabolism, rather than transcription. Multiple alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Apr 2010]
Transcript Variant: This variant (5) lacks an in-frame exon in the coding region, compared to variant 1. The encoded isoform (5) is shorter than isoform 1. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments.

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.