RBMS3 (NM_001177711) Human Untagged Clone
CAT#: SC328691
RBMS3 (untagged)-Human RNA binding motif single stranded interacting protein 3 (RBMS3) transcript variant 5
"NM_001177711" in other vectors (4)
Product Images
![](https://cdn.origene.com/img/defaults-img-expression-plasmids.jpg)
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Symbol | RBMS3 |
Synonyms | FLJ36544 |
Vector | pCMV6-Entry |
E. coli Selection | Kanamycin (25 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>NCBI ORF sequence for NM_001177711, the custom clone sequence may differ by one or more nucleotides
ATGGGCAAACGCCTGGATCAGCCACAAATGTACCCCCAGTACACTTACTACTATCCTCATTATCTCCAAA CCAAGCAGTCCTATGCACCAGCTCCCCACCCCATGGCTCCTCCCAGCCCCAGCACAAACAGCAGCAGCAA CAACAGCAGCAACAACAGCAGCGGGGAACAGTTGAGTAAAACCAACCTGTACATTCGAGGCCTCCCACCA GGCACCACTGACCAGGACCTAATCAAGCTGTGCCAACCGTATGGAAAAATTGTATCTACAAAGGCAATTC TTGACAAAAACACAAATCAGTGCAAAGGTTATGGTTTTGTAGATTTTGACAGTCCTGCAGCCGCACAGAA AGCGGTAGCATCTCTCAAGGCAAATGGCGTGCAGGCACAGATGGCTAAGCAACAAGAGCAAGACCCAACA AACCTATACATCTCAAATCTCCCCATTTCTATGGATGAGCAGGAGCTTGAGAATATGCTGAAACCCTTTG GACATGTCATTTCCACAAGAATACTAAGAGACGCTAATGGAGTCAGCAGAGGTGTTGGCTTTGCCAGAAT GGAGTCTACTGAAAAATGTGAAGTGGTAATTCAACATTTTAATGGAAAATATCTGAAAACACCACCAGGC ATCCCAGCCCCCAGTGAGCCTTTGCTGTGCAAATTCGCTGATGGAGGACAAAAGAAGCGACAGAATCAAA GCAAATATACCCAGAATGGGAGGCCTTGGCCCAGGGAAGGAGAGGCTGGCATGGCTTTGACCTATGACCC CACAGCTGCCATACAGAATGGATTTTATTCTTCACCGTACAGTATTGCAACCAACCGCATGATTCCACAG ACATCTATCACGCCATTCATTGCTGCTTCCCCTGTCTCCACATACCAGGTCCAGAGTACTTCATGGATGC CTCATCCGCCATACGTTATGCAACCAACAGGTGCTGTGATTACACCAACCATGGACCATCCCATGTCAAT GCAGCCAGCCAACATGATGGGCCCACTGACACAGCAGATGAATCACCTTTCGTTGGGCACAACAGGAACG TATATGACTGCTGCTGCTCCTATGCAAGGGACCTACATTCCTCAGTACACGCCTGTGCCTCCGACAGCTG TTTCTATTGAAGGTGTTGTTGCTGATACCTCTCCCCAGACAGTGGCACCTTCATCCCAGGACACCAGTGG TCAGCAGCAACAGATAGCAGTGGACACATCCAACGAACATGCACCTGCATATTCTTACCAACAGTCTAAA CCATAA |
Restriction Sites | SgfI-MluI |
ACCN | NM_001177711 |
ORF Size | 1266 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
Reference Data | |
RefSeq | NM_001177711.1, NP_001171182.1 |
RefSeq Size | 8186 |
RefSeq ORF | 1266 |
Locus ID | 27303 |
Gene Summary | This gene encodes an RNA-binding protein that belongs to the c-myc gene single-strand binding protein family. These proteins are characterized by the presence of two sets of ribonucleoprotein consensus sequence (RNP-CS) that contain conserved motifs, RNP1 and RNP2, originally described in RNA binding proteins, and required for DNA binding. These proteins have been implicated in such diverse functions as DNA replication, gene transcription, cell cycle progression and apoptosis. The encoded protein was isolated by virtue of its binding to an upstream element of the alpha2(I) collagen promoter. The observation that this protein localizes mostly in the cytoplasm suggests that it may be involved in a cytoplasmic function such as controlling RNA metabolism, rather than transcription. Multiple alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Apr 2010] Transcript Variant: This variant (5) lacks an in-frame exon in the coding region, compared to variant 1. The encoded isoform (5) is shorter than isoform 1. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments. |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC230053 | RBMS3 (Myc-DDK-tagged)-Human RNA binding motif, single stranded interacting protein 3 (RBMS3), transcript variant 5 |
USD 420.00 |
|
RG230053 | RBMS3 (GFP-tagged) - Human RNA binding motif, single stranded interacting protein 3 (RBMS3), transcript variant 5 |
USD 460.00 |
|
RC230053L3 | Lenti ORF clone of Human RNA binding motif, single stranded interacting protein 3 (RBMS3), transcript variant 5, Myc-DDK-tagged |
USD 620.00 |
|
RC230053L4 | Lenti ORF clone of Human RNA binding motif, single stranded interacting protein 3 (RBMS3), transcript variant 5, mGFP tagged |
USD 620.00 |
{0} Product Review(s)
Be the first one to submit a review