UDP glucose dehydrogenase (UGDH) (NM_001184700) Human Untagged Clone

CAT#: SC328700

UGDH (untagged)-Human UDP-glucose 6-dehydrogenase (UGDH) transcript variant 2

Specifications

Product Data

• Type: Human Untagged Clone
• Tag: Tag Free
• Symbol: UGDH
• Synonyms: GDH; UDP-GlcDH; UDPGDH; UGD
• Vector: pCMV6-Entry
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Sequence Data:
  Fully Sequenced ORF

  >NCBI ORF sequence for NM_001184700, the custom clone sequence may differ by one or more nucleotides
  
  
  ATGTTTGAAATTAAGAAGATCTGTTGCATCGGTGCAGGCTATGTTGGAGGACCCACATGTAGTGTCATTG
  CTCATATGTGTCCTGAAATCAGGGTAACGGTTGTTGATGTCAATGAATCAAGAATCAATGCGTGGAATTC
  TCCTACACTTCCTATTTATGAGCCAGGACTAAAAGAAGTGGTAGAATCCTGTCGAGGAAAAAATCTTTTT
  TTTTCTACCAATATTGATGATGCCATCAAAGAAGCTGATCTTGTATTTATTTCTGTGCTGTCCAACCCTG
  AGTTTCTGGCAGAGGGAACAGCCATCAAGGACCTAAAGAACCCAGACAGAGTACTGATTGGAGGGGATGA
  AACTCCAGAGGGCCAGAGAGCTGTGCAGGCCCTGTGTGCTGTATATGAGCACTGGGTTCCCAGAGAAAAG
  ATCCTCACCACTAATACTTGGTCTTCAGAGCTTTCCAAACTGGCAGCAAATGCTTTTCTTGCCCAGAGAA
  TAAGCAGCATTAACTCCATAAGTGCTCTGTGTGAAGCAACAGGAGCTGATGTAGAAGAGGTAGCAACAGC
  GATTGGAATGGACCAGAGAATTGGAAACAAGTTTCTAAAAGCCAGTGTTGGGTTTGGTGGGAGCTGTTTC
  CAAAAGGATGTTCTGAATTTGGTTTATCTCTGTGAGGCTCTGAATTTGCCAGAAGTAGCTCGTTATTGGC
  AGCAGGTCATAGACATGAATGACTACCAGAGGAGGAGGTTTGCTTCCCGGATCATAGATAGTCTGTTTAA
  TACAGTAACTGATAAGAAGATAGCTATTTTGGGATTTGCATTCAAAAAGGACACTGGTGATACAAGAGAA
  TCTTCTAGTATATATATTAGCAAATATTTGATGGATGAAGGTGCACATCTACATATATATGATCCAAAAG
  TACCTAGGGAACAAATAGTTGTGGATCTTTCTCATCCAGGTGTTTCAGAGGATGACCAAGTGTCCCGGCT
  CGTGACCATTTCCAAGGATCCATATGAAGCATGTGATGGTGCCCATGCTGTTGTTATTTGCACTGAGTGG
  GACATGTTTAAGGAATTGGATTATGAACGCATTCATAAAAAAATGCTAAAGCCAGCCTTTATCTTCGATG
  GACGGCGTGTCCTGGATGGGCTCCACAATGAACTACAAACCATTGGCTTCCAGATTGAAACAATTGGCAA
  AAAGGTGTCTTCAAAGAGAATTCCATATGCTCCTTCTGGTGAAATTCCGAAGTTTAGTCTTCAAGATCCA
  CCTAACAAGAAACCTAAAGTGTAG
  
  
• Restriction Sites: SgfI-MluI
• ACCN: NM_001184700
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
• OTI Annotation: This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
• Product Components: The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones.
• Reconstitution: 1. Centrifuge at 5,000xg for 5min.
  2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
  3. Close the tube and incubate for 10 minutes at room temperature.
  4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
  5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.

Reference Data

• RefSeq: NM_001184700.1, NP_001171629.1
• RefSeq Size: 3013 bp
• RefSeq ORF: 1284 bp
• Locus ID: 7358
• Cytogenetics: 4p14
• Protein Pathways: Amino sugar and nucleotide sugar metabolism, Ascorbate and aldarate metabolism, Metabolic pathways, Pentose and glucuronate interconversions, Starch and sucrose metabolism
• Gene Summary: 'The protein encoded by this gene converts UDP-glucose to UDP-glucuronate and thereby participates in the biosynthesis of glycosaminoglycans such as hyaluronan, chondroitin sulfate, and heparan sulfate. These glycosylated compounds are common components of the extracellular matrix and likely play roles in signal transduction, cell migration, and cancer growth and metastasis. The expression of this gene is up-regulated by transforming growth factor beta and down-regulated by hypoxia. Alternative splicing results in multiple transcript variants.[provided by RefSeq, May 2010]'
  Transcript Variant: This variant (2) lacks an exon in the coding region, compared to variant 1. The encoded isoform (2) is shorter, compared to isoform 1. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments.