PC1/3 (PCSK1) (NM_001177876) Human Untagged Clone
CAT#: SC328728
PCSK1 (untagged)-Human proprotein convertase subtilisin/kexin type 1 (PCSK1) transcript variant 3
"NM_001177876" in other vectors (4)
Product Images
![](https://cdn.origene.com/img/defaults-img-expression-plasmids.jpg)
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Symbol | PCSK1 |
Synonyms | BMIQ12; NEC1; PC1; PC3; SPC3 |
Vector | pCMV6-Entry |
E. coli Selection | Kanamycin (25 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>NCBI ORF sequence for NM_001177876, the custom clone sequence may differ by one or more nucleotides
ATGCTGGATGGCATTGTGACGGATGCTATTGAGGCCAGTTCAATTGGATTCAATCCTGGACACGTGGATA TTTACAGTGCAAGCTGGGGCCCTAATGATGATGGGAAAACTGTGGAGGGGCCTGGCCGGCTAGCCCAGAA GGCTTTTGAATATGGTGTCAAACAGACGAGCGCTGACCTGCACAATGACTGCACGGAGACGCACACAGGC ACCTCGGCCTCTGCACCTCTGGCTGCTGGCATCTTCGCTCTGGCCCTGGAAGCAAACCCAAATCTCACCT GGCGAGATATGCAGCACCTGGTTGTCTGGACCTCTGAGTATGACCCGCTGGCCAATAACCCTGGATGGAA AAAGAATGGAGCAGGCTTGATGGTGAATAGTCGATTTGGATTTGGCTTGCTAAATGCCAAAGCTCTGGTG GATTTAGCTGACCCCAGGACCTGGAGGAGCGTGCCTGAGAAGAAAGAGTGTGTTGTAAAGGACAATGACT TTGAGCCCAGAGCCCTGAAAGCTAATGGAGAAGTTATCATTGAAATTCCAACAAGAGCTTGTGAAGGACA AGAAAATGCTATCAAGTCCCTGGAGCATGTACAATTTGAAGCAACAATTGAATATTCCCGAAGAGGAGAC CTTCATGTCACACTTACTTCTGCTGCTGGAACTAGCACTGTGCTCTTGGCTGAAAGAGAACGGGATACAT CTCCTAATGGCTTTAAGAATTGGGACTTCATGTCTGTTCACACATGGGGAGAGAACCCTATAGGTACTTG GACTTTGAGAATTACAGACATGTCTGGAAGAATTCAAAATGAAGGAAGAATTGTGAACTGGAAGCTGATT TTGCACGGGACCTCTTCTCAGCCAGAGCATATGAAGCAGCCTCGTGTGTACACGTCCTACAACACTGTTC AGAATGACAGAAGAGGGGTGGAGAAGATGGTGGATCCAGGGGAGGAGCAGCCCACACAAGAGAACCCTAA GGAGAACACCCTGGTGTCCAAAAGCCCCAGCAGCAGCAGCGTAGGGGGCCGGAGGGATGAGTTGGAGGAG GGAGCCCCTTCCCAGGCCATGCTGCGACTCCTGCAAAGTGCTTTCAGTAAAAACTCACCGCCAAAGCAAT CACCAAAGAAGTCCCCAAGTGCAAAGCTCAACATCCCTTATGAAAACTTCTACGAAGCCCTGGAAAAGCT GAACAAACCTTCCCAGCTTAAAGACTCTGAAGACAGTCTGTATAATGACTATGTTGATGTTTTTTATAAC ACTAAACCTTACAAGCACAGAGACGACCGGCTGCTTCAAGCTCTGGTGGACATTCTGAATGAGGAAAATT AA |
Restriction Sites | SgfI-MluI |
ACCN | NM_001177876 |
ORF Size | 1332 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
Reference Data | |
RefSeq | NM_001177876.1, NP_001171347.1 |
RefSeq Size | 4070 |
RefSeq ORF | 1332 |
Locus ID | 5122 |
Protein Families | Druggable Genome, Protease, Secreted Protein |
Gene Summary | This gene encodes a member of the subtilisin-like proprotein convertase family, which includes proteases that process protein and peptide precursors trafficking through regulated or constitutive branches of the secretory pathway. The encoded protein undergoes an initial autocatalytic processing event in the ER to generate a heterodimer which exits the ER and sorts to subcellular compartments where a second autocatalytic even takes place and the catalytic activity is acquired. The protease is packaged into and activated in dense core secretory granules and expressed in the neuroendocrine system and brain. This gene encodes one of the seven basic amino acid-specific members which cleave their substrates at single or paired basic residues. It functions in the proteolytic activation of polypeptide hormones and neuropeptides precursors. Mutations in this gene have been associated with susceptibility to obesity and proprotein convertase 1/3 deficiency. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene [provided by RefSeq, Jan 2014] Transcript Variant: This variant (3) differs in the 5' UTR, lacks a portion of the 5' coding region, and initiates translation at a downstream start codon compared to variant 1. The encoded isoform (3) has a distinct N-terminus and is shorter than isoform 1. |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC230090 | PCSK1 (Myc-DDK-tagged)-Human proprotein convertase subtilisin/kexin type 1 (PCSK1), transcript variant 3 |
USD 470.00 |
|
RG230090 | PCSK1 (GFP-tagged) - Human proprotein convertase subtilisin/kexin type 1 (PCSK1), transcript variant 3 |
USD 520.00 |
|
RC230090L3 | Lenti ORF clone of Human proprotein convertase subtilisin/kexin type 1 (PCSK1), transcript variant 3, Myc-DDK-tagged |
USD 670.00 |
|
RC230090L4 | Lenti ORF clone of Human proprotein convertase subtilisin/kexin type 1 (PCSK1), transcript variant 3, mGFP tagged |
USD 670.00 |
{0} Product Review(s)
Be the first one to submit a review