LPP (NM_001167672) Human Untagged Clone
CAT#: SC328768
LPP (untagged)-Human LIM domain containing preferred translocation partner in lipoma (LPP) transcript variant 3
"NM_001167672" in other vectors (4)
Product Images
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Symbol | LPP |
Synonyms | DKFZp779O0231; FLJ30652; FLJ41512 |
Vector | pCMV6-Entry |
E. coli Selection | Kanamycin (25 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>NCBI ORF sequence for NM_001167672, the custom clone sequence may differ by one or more nucleotides
ATGTCTCACCCATCTTGGCTGCCACCCAAAAGCACTGGTGAGCCCCTCGGCCATGTGCCTGCACGGATGG AGACCACCCATTCCTTTGGGAACCCCAGCATTTCAGTGTCTACACAACAGCCACCCAAAAAGTTTGCCCC GGTAGTTGCTCCAAAACCTAAGTACAACCCATACAAACAACCTGGAGGTGAGGGTGATTTTCTTCCACCC CCACCTCCACCTCTAGATGATTCCAGTGCCCTTCCATCTATCTCTGGAAACTTTCCTCCTCCACCACCTC TTGATGAAGAGGCTTTCAAAGTACAGGGGAATCCCGGAGGCAAGACACTTGAGGAGAGGCGCTCCAGCCT GGACGCTGAGATTGACTCCTTGACCAGCATCTTGGCTGACCTTGAGTGCAGCTCCCCCTATAAGCCTCGG CCTCCACAGAGCTCCACTGGTTCAACAGCCTCTCCTCCAGTTTCGACCCCAGTCACAGGACACAAGAGAA TGGTCATCCCGAACCAACCCCCTCTAACAGCAACCAAGAAGTCTACATTGAAACCACAGCCTGCACCCCA GGCTGGACCCATCCCTGTGGCTCCAATCGGAACACTCAAACCCCAGCCTCAGCCAGTCCCAGCCTCCTAC ACCACGGCCTCCACTTCTTCAAGGCCTACCTTTAATGTGCAGGGTGGCCATTCAGGGCAACTGGGGCCTT CGTCAGTTGCCCCTTCATTCCGCCCAGAGGATGAGCTTGAGCACCTGACCAAAAAGATGCTGTATGACAT GGAAAATCCACCTGCTGACGAATACTTTGGCCGCTGTGCTCGCTGTGGAGAAAACGTAGTTGGGGAAGGT ACAGGATGCACTGCCATGGATCAGGTCTTCCACGTGGATTGTTTTACCTGCATCATCTGCAACAACAAGC TCCGAGGGCAGCCATTCTATGCTGTGGAAAAGAAAGCATACTGCGAGCCCTGCTACATTAATACTCTGGA GCAGTGCAATGTGTGTTCCAAGCCCATCATGGAGCGGATTCTCCGAGCCACCGGGAAGGCCTATCATCCT CACTGTTTCACCTGCGTGATGTGCCACCGCAGCCTGGATGGGATCCCATTCACTGTGGATGCTGGCGGGC TCATTCACTGCATTGAGGACTTCCACAAGAAATTTGCCCCGCGATGTTCTGTGTGCAAGGAGCCTATTAT GCCAGCCCCGGGCCAGGAGGAGACTGTCCGTATTGTGGCTTTGGATCGAGATTTCCATGTTCACTGCTAC CGATGCGAGGATTGCGGTGGTCTCCTGTCTGAAGGAGATAACCAAGGCTGCTACCCCTTGGATGGGCACA TCCTCTGCAAGACCTGCAACTCTGCCCGCATCAGGGTGTTGACCGCCAAGGCGAGCACTGACCTTTAG |
Restriction Sites | SgfI-MluI |
ACCN | NM_001167672 |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
Product Components | The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones. |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Reference Data | |
RefSeq | NM_001167672.2, NP_001161144.1 |
RefSeq Size | 17767 bp |
RefSeq ORF | 1398 bp |
Locus ID | 4026 |
Cytogenetics | 3q27.3-q28 |
Gene Summary | 'This gene encodes a member of a subfamily of LIM domain proteins that are characterized by an N-terminal proline-rich region and three C-terminal LIM domains. The encoded protein localizes to the cell periphery in focal adhesions and may be involved in cell-cell adhesion and cell motility. This protein also shuttles through the nucleus and may function as a transcriptional co-activator. This gene is located at the junction of certain disease-related chromosomal translocations, which result in the expression of chimeric proteins that may promote tumor growth. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jul 2014]' Transcript Variant: This variant (3) contains alternate 5' exon structure and thus differs in the 5' UTR, and it uses an alternate in-frame splice site in the central coding region, compared to variant 1. The resulting isoform (b) lacks an internal segment, compared to isoform a. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments. |
Documents
Product Manuals |
FAQs |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC230130 | LPP (Myc-DDK-tagged)-Human LIM domain containing preferred translocation partner in lipoma (LPP), transcript variant 3 |
USD 420.00 |
|
RG230130 | LPP (GFP-tagged) - Human LIM domain containing preferred translocation partner in lipoma (LPP), transcript variant 3 |
USD 460.00 |
|
RC230130L3 | Lenti-ORF clone of LPP (Myc-DDK-tagged)-Human LIM domain containing preferred translocation partner in lipoma (LPP), transcript variant 3 |
USD 620.00 |
|
RC230130L4 | Lenti-ORF clone of LPP (mGFP-tagged)-Human LIM domain containing preferred translocation partner in lipoma (LPP), transcript variant 3 |
USD 620.00 |
{0} Product Review(s)
Be the first one to submit a review