MEF2A (NM_001171894) Human Untagged Clone
CAT#: SC328816
MEF2A (untagged)-Human myocyte enhancer factor 2A (MEF2A) transcript variant 5
"NM_001171894" in other vectors (4)
Product Images
![](https://cdn.origene.com/img/defaults-img-expression-plasmids.jpg)
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Symbol | MEF2A |
Synonyms | ADCAD1; mef2; RSRFC4; RSRFC9 |
Vector | pCMV6-Entry |
E. coli Selection | Kanamycin (25 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>NCBI ORF sequence for NM_001171894, the custom clone sequence may differ by one or more nucleotides
ATGGGGCGGAAGAAAATACAAATCACACGCATAATGGATGAAAGGAACCGACAGGTCACTTTTACAAAGA GAAAGTTTGGATTAATGAAGAAAGCCTATGAACTTAGTGTGCTCTGTGACTGTGAAATAGCACTCATCAT TTTCAACAGCTCTAACAAACTGTTTCAATATGCTAGCACTGATATGGACAAAGTTCTTCTCAAGTATACA GAATATAATGAACCTCATGAAAGCAGAACCAACTCGGATATTGTTGAGACTTTAAGAAAGAAAGGCCTTA ATGGTTGTGAGAGCCCTGATGCTGACGATTACTTTGAGCACAGTCCACTCTCGGAGGACAGATTCAGCAA ACTAAATGAAGATAGTGATTTTATTTTCAAACGAGGCCCTCCTGGTCTGCCACCTCAGAACTTTTCAATG TCTGTCACAGTTCCAGTGACCAGCCCCAATGCTTTGTCCTACACTAACCCAGGGAGTTCACTGGTGTCCC CATCTTTGGCAGCCAGCTCAACGTTAACAGATTCAAGCATGCTCTCTCCACCTCAAACCACATTACATAG AAATGTGTCTCCTGGAGCTCCTCAGAGACCACCAAGTACTGGCAATGCAGGTGGGATGTTGAGCACTACA GACCTCACAGTGCCAAATGGAGCTGGAAGCAGTCCAGTGGGGAATGGATTTGTAAACTCAAGAGCTTCTC CAAATTTGATTGGAGCTACTGGTGCAAATAGCTTAGGCAAAGTCATGCCTACAAAGTCTCCCCCTCCACC AGGTGGTGGTAATCTTGGAATGAACAGTAGGAAACCAGATCTTCGAGTTGTCATCCCCCCTTCAAGCAAG GGCATGATGCCTCCACTAAATACCCAGAGGATCAGTAGTTCTCAAGCCACTCAACCTCTTGCTACCCCAG TCGTGTCTGTGACAACCCCAAGCTTGCCTCCGCAAGGACTTGTGTACTCAGCAATGCCGACTGCCTACAA CACTGATTATTCACTGACCAGCGCTGACCTGTCAGCCCTTCAAGGCTTCAACTCGCCAGGAATGCTGTCG CTGGGACAGGTGTCGGCCTGGCAGCAGCACCACCTAGGACAAGCAGCCCTCAGCTCTCTTGTTGCTGGAG GGCAGTTATCTCAGGGTTCCAATTTATCCATTAATACCAACCAAAACATCAGCATCAAGTCCGAACCGAT TTCACCTCCTCGGGATCGTATGACCCCATCGGGCTTCCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAG CCGCCGCCACCACCGCAGCCCCAGCCACAACCCCCGCAGCCCCAGCCCCGACAGGAAATGGGGCGCTCCC CTGTGGACAGTCTGAGCAGCTCTAGTAGCTCCTATGATGGCAGTGATCGGGAGGATCCACGGGGCGACTT CCATTCTCCAATTGTGCTTGGCCGACCCCCAAACACTGAGGACAGAGAAAGCCCTTCTGTAAAGCGAATG AGGATGGACGCGTGGGTGACCTAA |
Restriction Sites | SgfI-RsrII |
ACCN | NM_001171894 |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
Product Components | The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones. |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Reference Data | |
RefSeq | NM_001171894.2, NP_001165365.1 |
RefSeq Size | 5838 bp |
RefSeq ORF | 1494 bp |
Locus ID | 4205 |
Cytogenetics | 15q26.3 |
Protein Families | Transcription Factors |
Gene Summary | 'The protein encoded by this gene is a DNA-binding transcription factor that activates many muscle-specific, growth factor-induced, and stress-induced genes. The encoded protein can act as a homodimer or as a heterodimer and is involved in several cellular processes, including muscle development, neuronal differentiation, cell growth control, and apoptosis. Defects in this gene could be a cause of autosomal dominant coronary artery disease 1 with myocardial infarction (ADCAD1). Several transcript variants encoding different isoforms have been found for this gene.[provided by RefSeq, Jan 2010]' Transcript Variant: This variant (5) lacks an in-frame coding exon and contains an additional 5' non-coding exon, compared to transcript variant 6. These differences result in a shorter isoform (2), compared to isoform 5. Variants 2 and 5 both encode isoform 2. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments. |
Documents
Product Manuals |
FAQs |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC230178 | MEF2A (Myc-DDK-tagged)-Human myocyte enhancer factor 2A (MEF2A), transcript variant 5 |
USD 420.00 |
|
RG230178 | MEF2A (GFP-tagged) - Human myocyte enhancer factor 2A (MEF2A), transcript variant 5 |
USD 460.00 |
|
RC230178L3 | Lenti-ORF clone of MEF2A (Myc-DDK-tagged)-Human myocyte enhancer factor 2A (MEF2A), transcript variant 5 |
USD 620.00 |
|
RC230178L4 | Lenti-ORF clone of MEF2A (mGFP-tagged)-Human myocyte enhancer factor 2A (MEF2A), transcript variant 5 |
USD 620.00 |
{0} Product Review(s)
Be the first one to submit a review