IL11 (NM_001267718) Human Untagged Clone

CAT#: SC329401

IL11 (untagged) - Homo sapiens interleukin 11 (IL11), transcript variant 2

Specifications

Product Data

• Type: Human Untagged Clone
• Tag: Tag Free
• Symbol: IL11
• Synonyms: AGIF; IL-11
• Vector: pCMV6 series
• Sequence Data:
  Fully Sequenced ORF

  >NCBI ORF sequence for NM_001267718, the custom clone sequence may differ by one or more nucleotides
  
  
  ATGAGTGCGGGGGCACTGGGAGCTCTACAGCTCCCAGGTGTGCTGACAAGGCTGCGAGCGGACCTACTGT
  CCTACCTGCGGCACGTGCAGTGGCTGCGCCGGGCAGGTGGCTCTTCCCTGAAGACCCTGGAGCCCGAGCT
  GGGCACCCTGCAGGCCCGACTGGACCGGCTGCTGCGCCGGCTGCAGCTCCTGATGTCCCGCCTGGCCCTG
  CCCCAGCCACCCCCGGACCCGCCGGCGCCCCCGCTGGCGCCCCCCTCCTCAGCCTGGGGGGGCATCAGGG
  CCGCCCACGCCATCCTGGGGGGGCTGCACCTGACACTTGACTGGGCCGTGAGGGGACTGCTGCTGCTGAA
  GACTCGGCTGTGA
  
  
• Restriction Sites: SgfI-MluI
• ACCN: NM_001267718
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
• Product Components: The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones.
• Reconstitution: 1. Centrifuge at 5,000xg for 5min.
  2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
  3. Close the tube and incubate for 10 minutes at room temperature.
  4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
  5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.

Reference Data

• RefSeq: NM_001267718.1, NP_001254647.1
• RefSeq Size: 2208 bp
• RefSeq ORF: 363 bp
• Locus ID: 3589
• Cytogenetics: 19q13.42
• Protein Families: Druggable Genome, Secreted Protein
• Protein Pathways: Cytokine-cytokine receptor interaction, Hematopoietic cell lineage, Jak-STAT signaling pathway
• Gene Summary: 'The protein encoded by this gene is a member of the gp130 family of cytokines. These cytokines drive the assembly of multisubunit receptor complexes, all of which contain at least one molecule of the transmembrane signaling receptor IL6ST (gp130). This cytokine is shown to stimulate the T-cell-dependent development of immunoglobulin-producing B cells. It is also found to support the proliferation of hematopoietic stem cells and megakaryocyte progenitor cells. Alternatively spliced transcript variants encoding distinct isoforms have been found for this gene. [provided by RefSeq, Jun 2012]'
  Transcript Variant: This variant (2) lacks an exon in the 5' coding region, which results in a downstream in-frame start codon, compared to variant 1. The resulting isoform (2) has a shorter N-terminus, compared to isoform 1. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments.