LIMS1 (NM_001193488) Human Untagged Clone

CAT#: SC329435

LIMS1 (untagged) - Homo sapiens LIM and senescent cell antigen-like domains 1 (LIMS1), transcript variant 3

Specifications

Product Data

• Type: Human Untagged Clone
• Tag: Tag Free
• Symbol: LIMS1
• Synonyms: PINCH; PINCH-1; PINCH1
• Vector: pCMV6 series
• Sequence Data:
  Fully Sequenced ORF

  >NCBI ORF sequence for NM_001193488, the custom clone sequence may differ by one or more nucleotides
  
  
  ATGGCCAACGCCCTGGCCAGCGCCACTTGCGAGCGCTGCAAGGGCGGCTTTGCGCCCGCTGAGAAGATCG
  TGAACAGTAATGGGGAGCTGTACCATGAGCAGTGTTTCGTGTGCGCTCAGTGCTTCCAGCAGTTCCCAGA
  AGGACTCTTCTATGAGTTTGAAGGAAGAAAGTACTGTGAACATGACTTTCAGATGCTCTTTGCCCCTTGC
  TGTCATCAGTGTGGTGAATTCATCATTGGCCGAGTTATCAAAGCCATGAATAACAGCTGGCATCCGGAGT
  GCTTCCGCTGTGACCTCTGCCAGGAAGTTCTGGCAGATATCGGGTTTGTCAAGAATGCTGGGAGACACCT
  GTGTCGCCCCTGTCATAATCGTGAGAAAGCCAGAGGCCTTGGGAAATACATCTGCCAGAAATGCCATGCT
  ATCATCGATGAGCAGCCTCTGATATTCAAGAACGACCCCTACCATCCAGACCATTTCAACTGCGCCAACT
  GCGGGAAGGAGCTGACTGCCGATGCACGGGAGCTGAAAGGGGAGCTATACTGCCTCCCATGCCATGATAA
  AATGGGGGTCCCCATCTGTGGTGCTTGCCGACGGCCCATCGAAGGGCGCGTGGTGAACGCTATGGGCAAG
  CAGTGGCATGTGGAGCATTTTGTTTGTGCCAAGTGTGAGAAACCCTTTCTTGGACATCGCCATTATGAGA
  GGAAAGGCCTGGCATATTGTGAAACTCACTATAACCAGCTATTTGGTGATGTTTGCTTCCACTGCAATCG
  TGTTATAGAAGGTGATGTGGTCTCTGCTCTTAATAAGGCCTGGTGCGTGAACTGCTTTGCCTGTTCTACC
  TGCAACACTAAATTAACACTCAAGAATAAGTTTGTGGAGTTTGACATGAAGCCAGTCTGTAAGAAGTGCT
  ATGAGAAATTTCCATTGGAGCTGAAGAAAAGACTTAAGAAACTAGCTGAGACCTTAGGAAGGAAATAA
  
  
• Restriction Sites: SgfI-MluI
• ACCN: NM_001193488
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
• Product Components: The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones.
• Reconstitution: 1. Centrifuge at 5,000xg for 5min.
  2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
  3. Close the tube and incubate for 10 minutes at room temperature.
  4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
  5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.

Reference Data

• RefSeq: NM_001193488.1, NP_001180417.1
• RefSeq Size: 4407 bp
• RefSeq ORF: 978 bp
• Locus ID: 3987
• Cytogenetics: 2q12.3
• Protein Families: Druggable Genome
• Gene Summary: 'The protein encoded by this gene is an adaptor protein which contains five LIM domains, or double zinc fingers. The protein is likely involved in integrin signaling through its LIM domain-mediated interaction with integrin-linked kinase, found in focal adhesion plaques. It is also thought to act as a bridge linking integrin-linked kinase to NCK adaptor protein 2, which is involved in growth factor receptor kinase signaling pathways. Its localization to the periphery of spreading cells also suggests that this protein may play a role in integrin-mediated cell adhesion or spreading. Several transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2010]'
  Transcript Variant: This variant (3) differs in the 5' UTR, lacks a portion of the 5' coding region and initiates translation at a downstream, in-frame start codon, compared to variant 1. The encoded isoform (b) has a shorter N-terminus compared to isoform a. Variants 2 and 3 both encode the same isoform (b). Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments.