CSRP1 (NM_001193571) Human Untagged Clone

CAT#: SC329436

CSRP1 (untagged) - Homo sapiens cysteine and glycine-rich protein 1 (CSRP1), transcript variant 4


  "NM_001193571" in other vectors (2)

Reconstitution Protocol

USD 310.00

3 Weeks*

Size
    • 10 ug

Product Images

Other products for "CSRP1"

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Symbol CSRP1
Synonyms CRP; CRP1; CSRP; CYRP; D1S181E; HEL-141; HEL-S-286
Vector pCMV6 series
Sequence Data
>NCBI ORF sequence for NM_001193571, the custom clone sequence may differ by one or more nucleotides


ATGCCGAACTGGGGAGGAGGCAAGAAATGTGGGGTGTGTCAGAAGACGGTTTACTTTGCCGAAGAGGTTC
AGTGCGAAGGCAACAGCTTCCATAAATCCTGCTTCCTGTGCATGGTCTGCAAGAAGAATCTGGACAGTAC
CACTGTGGCCGTGCATGGTGAGGAGATTTACTGCAAGTCCTGCTACGGCAAGAAGTATGGGCCCAAAGGC
TATGGCTACGGGCAGGGCGCAGGCACCCTCAGCACTGACAAGGGGGAGTCGCTGGGTATCAAGCACGAGG
AAGCCCCTGGCCACAGGCCCACCACCAACCCCAATGCATCCAAATTTGCCCAGAAGATTGGTGGCTCCGA
GCGCTGCCCCCGATGCAGCCAGGCAGTCTATGCTGCGGAGAAGGTGATTGGTGCTGGGAAGTCCTGGCAT
AAGGCCTGCTTTCGATGTGCCAAGTGTGGCAAAGGCCTTGAGTCAACCACCCTGGCAGACAAGGATGGCG
AGATTTACTGCAAAGGATGTTATGCTAAAAACTTCGGGCCCAAGGGCTTTGGTTTTGGGCAAGGAGCTGG
GGCCTTGGTCCACTCTGAGTGA


Restriction Sites SgfI-MluI     
ACCN NM_001193571
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones.
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_001193571.1, NP_001180500.1
RefSeq Size 1996 bp
RefSeq ORF 582 bp
Locus ID 1465
Cytogenetics 1q32.1
Gene Summary 'This gene encodes a member of the cysteine-rich protein (CSRP) family. This gene family includes a group of LIM domain proteins, which may be involved in regulatory processes important for development and cellular differentiation. The LIM/double zinc-finger motif found in this gene product occurs in proteins with critical functions in gene regulation, cell growth, and somatic differentiation. Alternatively spliced transcript variants have been described. [provided by RefSeq, Aug 2010]'
Transcript Variant: This variant (4) differs in the 5' UTR compared to variant 1. Variants 1, 4 and 5 encode the same isoform (1).

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.