CSRP1 (NM_001193572) Human Untagged Clone

CAT#: SC329437

CSRP1 (untagged) - Homo sapiens cysteine and glycine-rich protein 1 (CSRP1), transcript variant 5

Specifications

Product Data

• Type: Human Untagged Clone
• Tag: Tag Free
• Symbol: CSRP1
• Synonyms: CRP; CRP1; CSRP; CYRP; D1S181E; HEL-141; HEL-S-286
• Vector: pCMV6 series
• Sequence Data:
  Fully Sequenced ORF

  >NCBI ORF sequence for NM_001193572, the custom clone sequence may differ by one or more nucleotides
  
  
  ATGCCGAACTGGGGAGGAGGCAAGAAATGTGGGGTGTGTCAGAAGACGGTTTACTTTGCCGAAGAGGTTC
  AGTGCGAAGGCAACAGCTTCCATAAATCCTGCTTCCTGTGCATGGTCTGCAAGAAGAATCTGGACAGTAC
  CACTGTGGCCGTGCATGGTGAGGAGATTTACTGCAAGTCCTGCTACGGCAAGAAGTATGGGCCCAAAGGC
  TATGGCTACGGGCAGGGCGCAGGCACCCTCAGCACTGACAAGGGGGAGTCGCTGGGTATCAAGCACGAGG
  AAGCCCCTGGCCACAGGCCCACCACCAACCCCAATGCATCCAAATTTGCCCAGAAGATTGGTGGCTCCGA
  GCGCTGCCCCCGATGCAGCCAGGCAGTCTATGCTGCGGAGAAGGTGATTGGTGCTGGGAAGTCCTGGCAT
  AAGGCCTGCTTTCGATGTGCCAAGTGTGGCAAAGGCCTTGAGTCAACCACCCTGGCAGACAAGGATGGCG
  AGATTTACTGCAAAGGATGTTATGCTAAAAACTTCGGGCCCAAGGGCTTTGGTTTTGGGCAAGGAGCTGG
  GGCCTTGGTCCACTCTGAGTGA
  
  
• Restriction Sites: SgfI-MluI
• ACCN: NM_001193572
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
• Product Components: The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones.
• Reconstitution: 1. Centrifuge at 5,000xg for 5min.
  2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
  3. Close the tube and incubate for 10 minutes at room temperature.
  4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
  5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.

Reference Data

• RefSeq: NM_001193572.1, NP_001180501.1
• RefSeq Size: 1932 bp
• RefSeq ORF: 582 bp
• Locus ID: 1465
• Cytogenetics: 1q32.1
• Gene Summary: 'This gene encodes a member of the cysteine-rich protein (CSRP) family. This gene family includes a group of LIM domain proteins, which may be involved in regulatory processes important for development and cellular differentiation. The LIM/double zinc-finger motif found in this gene product occurs in proteins with critical functions in gene regulation, cell growth, and somatic differentiation. Alternatively spliced transcript variants have been described. [provided by RefSeq, Aug 2010]'
  Transcript Variant: This variant (5) differs in the 5' UTR compared to variant 1. Variants 1, 4 and 5 encode the same isoform (1).