DHFRL1 (DHFR2) (NM_001195643) Human Untagged Clone

CAT#: SC329459

DHFRL1 (untagged) - Homo sapiens dihydrofolate reductase-like 1 (DHFRL1), transcript variant 1


  "NM_001195643" in other vectors (2)

Reconstitution Protocol

USD 310.00

3 Weeks*

Size
    • 10 ug

Product Images

Other products for "DHFR2"

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Symbol DHFR2
Synonyms DHFRL1; DHFRP4
Vector pCMV6 series
Sequence Data
>NCBI ORF sequence for NM_001195643, the custom clone sequence may differ by one or more nucleotides


ATGTTTCTTTTGCTAAACTGCATCGTCGCTGTGTCCCAAAACATGGGCATCGGCAAGAACGGGGACCTGC
CCAGGCCGCCGCTCAGGAATGAATTCAGGTATTTCCAGAGAATGACCACAACTTCTTCAGTAGAGGGTAA
ACAGAATCTGGTGATTATGGGTAGGAAGACCTGGTTCTCCATTCCTGAGAAGAATCGACCTTTAAAGGAT
AGAATTAATTTAGTTCTCAGCAGAGAACTCAAGGAACCTCCACAAGGAGCTCATTTTCTTGCCAGAAGTT
TGGATGATGCCTTAAAACTTACTGAACGACCAGAATTAGCAAATAAAGTAGACATGATTTGGATAGTTGG
TGGCAGTTCTGTTTATAAGGAAGCCATGAATCACCTAGGCCATCTTAAACTATTTGTGACAAGGATCATG
CAGGACTTTGAAAGTGACACGTTTTTTTCAGAAATTGACTTGGAGAAATATAAACTTCTGCCTGAATACC
CAGGTGTTCTCTCTGATGTCCAGGAGGGGAAACACATCAAGTACAAATTTGAAGTATGTGAGAAGGATGA
TTAA


Restriction Sites SgfI-MluI     
ACCN NM_001195643
ORF Size 564 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Reference Data
RefSeq NM_001195643.1, NP_001182572.1
RefSeq Size 4047
RefSeq ORF 564
Locus ID 200895
Protein Families Druggable Genome
Gene Summary Key enzyme in folate metabolism. Contributes to the de novo mitochondrial thymidylate biosynthesis pathway. Required to prevent uracil accumulation in mtDNA. Binds its own mRNA and that of DHFR. [UniProtKB/Swiss-Prot Function]
Transcript Variant: This variant (1) is the longer transcript. Variants 1 and 2 encode the same protein. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments.

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.