DHFRL1 (DHFR2) (NM_001195643) Human Untagged Clone
CAT#: SC329459
DHFRL1 (untagged) - Homo sapiens dihydrofolate reductase-like 1 (DHFRL1), transcript variant 1
"NM_001195643" in other vectors (2)
Product Images
Other products for "DHFR2"
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Symbol | DHFR2 |
Synonyms | DHFRL1; DHFRP4 |
Vector | pCMV6 series |
Sequence Data |
>NCBI ORF sequence for NM_001195643, the custom clone sequence may differ by one or more nucleotides
ATGTTTCTTTTGCTAAACTGCATCGTCGCTGTGTCCCAAAACATGGGCATCGGCAAGAACGGGGACCTGC CCAGGCCGCCGCTCAGGAATGAATTCAGGTATTTCCAGAGAATGACCACAACTTCTTCAGTAGAGGGTAA ACAGAATCTGGTGATTATGGGTAGGAAGACCTGGTTCTCCATTCCTGAGAAGAATCGACCTTTAAAGGAT AGAATTAATTTAGTTCTCAGCAGAGAACTCAAGGAACCTCCACAAGGAGCTCATTTTCTTGCCAGAAGTT TGGATGATGCCTTAAAACTTACTGAACGACCAGAATTAGCAAATAAAGTAGACATGATTTGGATAGTTGG TGGCAGTTCTGTTTATAAGGAAGCCATGAATCACCTAGGCCATCTTAAACTATTTGTGACAAGGATCATG CAGGACTTTGAAAGTGACACGTTTTTTTCAGAAATTGACTTGGAGAAATATAAACTTCTGCCTGAATACC CAGGTGTTCTCTCTGATGTCCAGGAGGGGAAACACATCAAGTACAAATTTGAAGTATGTGAGAAGGATGA TTAA |
Restriction Sites | SgfI-MluI |
ACCN | NM_001195643 |
ORF Size | 564 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
Reference Data | |
RefSeq | NM_001195643.1, NP_001182572.1 |
RefSeq Size | 4047 |
RefSeq ORF | 564 |
Locus ID | 200895 |
Protein Families | Druggable Genome |
Gene Summary | Key enzyme in folate metabolism. Contributes to the de novo mitochondrial thymidylate biosynthesis pathway. Required to prevent uracil accumulation in mtDNA. Binds its own mRNA and that of DHFR. [UniProtKB/Swiss-Prot Function] Transcript Variant: This variant (1) is the longer transcript. Variants 1 and 2 encode the same protein. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments. |
Documents
Product Manuals |
FAQs |
SDS |
Resources
{0} Product Review(s)
0 Product Review(s)
Submit review
Be the first one to submit a review
Product Citations
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen
complexities in the preparation of your product. International customers may expect an additional 1-2 weeks
in shipping.