FPGT (NM_001199328) Human Untagged Clone
CAT#: SC329513
FPGT (untagged) - Homo sapiens fucose-1-phosphate guanylyltransferase (FPGT), transcript variant 3
"NM_001199328" in other vectors (2)
Product Images
![](https://cdn.origene.com/img/defaults-img-expression-plasmids.jpg)
Other products for "FPGT"
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Symbol | FPGT |
Synonyms | GFPP |
Vector | pCMV6 series |
Sequence Data |
>NCBI ORF sequence for NM_001199328, the custom clone sequence may differ by one or more nucleotides
ATGCGTGCTGTGCGGCGCGGTCTCAGGGAAGGTGGGGCTATGGCAGCTGCTAGGGACCCTCCGGAAGTAT CGCTGCGAGAAGCCACCCAGCGAAAATTGCGGAGGTTTTCCGAGCTAAGAGGCAAACTTGTAGCACGTGG AGAATTCTGGGACATAGTTGCAATAACAGCGGCTGATGAAAAACAGGAACTTGCTTACAACCAACAGCTG TCAGAAAAGCTGAAAAGAAAGGAGTTACCCCTTGGAGTTCAATATCACGTTTTTGTGGATCCTGCTGGAG CCAAAATTGGAAATGGAGGATCAACACTTTGTGCCCTTCAATGTTTGGAAAAGCTATATGGAGATAAATG GAATTCTTTTACCATCTTATTAATTCACTCTGGTGGCTACAGTCAACGACTTCCAAATGCAAGTGCTCTG GGAAAAATTTTCACTGCTTTACCTCTTGATATACCAGAATGCTCTGGCAAAACATCCTGTATCATTCAAA GCATACTGGATTCAAGATGTTCTGTGGCACCTGGCTCAGTTGTGGAGTATTCCAGATTGGGGCCTGATGT TTCAGTTGGGGAAAACTGCATTATTAGTGGTTCTTACATCCTAACAAAAGCTGCCCTCCCCGCACATTCT TTTGTATGTTCCTTAAGCTTAAAGATGAATAGATGCTTAAAGTATGCAACTATGGCATTTGGAGTGCAAG ACAACTTGAAAAAGAGTGTGAAAACATTGTCAGATATAAAGTTACTTCAATTCTTTGGAGTCTGTTTCCT GTCATGCTTAGATGTTTGGAATCTTAAAGTTACAGAGGAACTGTTCTCTGGTAACAAGACATGTCTGAGT TTGTGGACTGCACGCATTTTCCCAGTTTGTTCTTCTTTGAGTGACTCAGTTATAACATCCCTAAAGATGT TAAATGCTGTTAAGAACAAGTCAGCATTCAGCCTGAATAGCTATAAGTTGCTGTCCATTGAAGAAATGCT TATCTACAAAGATGTAGAAGATATGATAACTTACAGGGAACAAATTTTTCTAGAAATCAGTTTAAAAAGC AGTTTGATGTAG |
Restriction Sites | SgfI-MluI |
ACCN | NM_001199328 |
ORF Size | 1062 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
Reference Data | |
RefSeq | NM_001199328.2, NP_001186257.2 |
RefSeq Size | 3960 |
RefSeq ORF | 1062 |
Locus ID | 8790 |
Protein Pathways | Amino sugar and nucleotide sugar metabolism, Fructose and mannose metabolism, Metabolic pathways |
Gene Summary | L-fucose is a key sugar in glycoproteins and other complex carbohydrates since it may be involved in many of the functional roles of these macromolecules, such as in cell-cell recognition. The fucosyl donor for these fucosylated oligosaccharides is GDP-beta-L-fucose. There are two alternate pathways for the biosynthesis of GDP-fucose; the major pathway converts GDP-alpha-D-mannose to GDP-beta-L-fucose. The protein encoded by this gene participates in an alternate pathway that is present in certain mammalian tissues, such as liver and kidney, and appears to function as a salvage pathway to reutilize L-fucose arising from the turnover of glycoproteins and glycolipids. This pathway involves the phosphorylation of L-fucose to form beta-L-fucose-1-phosphate, and then condensation of the beta-L-fucose-1-phosphate with GTP by fucose-1-phosphate guanylyltransferase to form GDP-beta-L-fucose. Alternative splicing results in multiple transcript variants. Read-through transcription also exists between this gene and the neighboring downstream TNNI3 interacting kinase (TNNI3K) gene. [provided by RefSeq, Dec 2010] Transcript Variant: This variant (3) lacks a segment in the 3' coding region compared to variant 1. The encoded isoform (3) is shorter than isoform 1. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments. |
Documents
Product Manuals |
FAQs |
SDS |
Resources
{0} Product Review(s)
0 Product Review(s)
Submit review
Be the first one to submit a review
Product Citations
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen
complexities in the preparation of your product. International customers may expect an additional 1-2 weeks
in shipping.