RPL17-C18orf32 (NM_001199355) Human Untagged Clone
CAT#: SC329521
RPL17 (untagged) - Homo sapiens RPL17-C18orf32 readthrough (RPL17-C18orf32), transcript variant 1
"NM_001199355" in other vectors (2)
Product Images
![](https://cdn.origene.com/img/defaults-img-expression-plasmids.jpg)
Other products for "RPL17-C18orf32"
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Symbol | RPL17-C18orf32 |
Synonyms | PD-1; RPL17 |
Vector | pCMV6 series |
Sequence Data |
>NCBI ORF sequence for NM_001199355, the custom clone sequence may differ by one or more nucleotides
ATGGTTCGCTATTCACTTGACCCGGAGAACCCCACGAAATCATGCAAATCAAGAGGTTCCAATCTTCGTG TTCACTTTAAGAACACTCGTGAAACTGCTCAGGCCATCAAGGGTATGCATATACGAAAAGCCACGAAGTA TCTGAAAGATGTCACTTTACAGAAACAGTGTGTACCATTCCGACGTTACAATGGTGGAGTTGGCAGGTGT GCGCAGGCCAAGCAATGGGGCTGGACACAAGGTCGGTGGCCCAAAAAGAGTGCTGAATTTTTGCTGCACA TGCTTAAAAACGCAGAGAGTAATGCTGAACTTAAGGGTTTAGATGTAGATTCTCTGGTCATTGAGCATAT CCAAGTGAACAAAGCACCTAAGATGCGCCGCCGGACCTACAGAGCTCATGGTCGGATTAACCCATACATG AGCTCTCCCTGCCACATTGAGATGATCCTTACGGAAAAGGAACAGATTGTTCCTAAACCAGAAGAGGAGG TTGCCCAGAAGAAAAAGTTGAGGAGCTCAAGCTTGGGAAAATGGTGTGCATTCCTTGTATCGTCATTCCA GTTCTGCTCTGGATCTACAAAAAATTCCTGGAGCCATATATATACCCTCTGGTTTCCCCCTTCGTTAGTC GTATATGGCCTAAGAAAGCAATACAAGAATCCAATGATACAAACAAAGGCAAAGTAA |
Restriction Sites | SgfI-MluI |
ACCN | NM_001199355 |
ORF Size | 687 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
Reference Data | |
RefSeq | NM_001199355.1, NP_001186284.1 |
RefSeq Size | 1941 |
RefSeq ORF | 687 |
Locus ID | 100526842 |
Gene Summary | This locus represents naturally occurring read-through transcription between the neighboring RPL17 (ribosomal protein L17) and C18orf32 (chromosome 18 open reading frame 32) genes. Alternative splicing results in multiple transcript variants. The encoded isoforms share sequence identity with the RPL17 protein, but they include frameshifted C-terminal regions derived from the downstream gene exons. [provided by RefSeq, Dec 2010] Transcript Variant: This variant (1) represents the shorter transcript but encodes the longer isoform (1). The 5' UTR of this variant is incomplete due to lack of full-length transcript support for this exon combination, and the presence of ambiguous splicing in the 5' region. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments. |
Documents
Product Manuals |
FAQs |
SDS |
Resources
{0} Product Review(s)
0 Product Review(s)
Submit review
Be the first one to submit a review
Product Citations
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen
complexities in the preparation of your product. International customers may expect an additional 1-2 weeks
in shipping.