CIDE C (CIDEC) (NM_001199552) Human Untagged Clone

CAT#: SC329533

CIDEC (untagged) - Homo sapiens cell death-inducing DFFA-like effector c (CIDEC), transcript variant 4

Specifications

Product Data

• Type: Human Untagged Clone
• Tag: Tag Free
• Symbol: CIDEC
• Synonyms: CIDE-3; CIDE3; FPLD5; FSP27
• Vector: pCMV6 series
• Sequence Data:
  Fully Sequenced ORF

  >NCBI ORF sequence for NM_001199552, the custom clone sequence may differ by one or more nucleotides
  
  
  ATGGAATACGCCATGAAGTCCCTTAGCCTTCTCTACCCCAAGTCCCTCTCCAGGCATGTGTCAGTGCGTA
  CCTCTGTGGTGACCCAGCAGCTGCTGTCGGAGCCCAGCCCCAAGGCCCCCAGGGCCCGGCCCTGCCGCGT
  AAGCACGGCGGATCGAAGCGTGAGGAAGGGCATCATGGCTTACAGTCTTGAGGACCTCCTCCTCAAGGTC
  CGGGACACTCTGATGCTGGCAGACAAGCCCTTCTTCCTGGTGCTGGAGGAAGATGGCACAACTGTAGAGA
  CAGAAGAGTACTTCCAAGCCCTGGCAGGGGATACAGTGTTCATGGTCCTCCAGAAGGGGCAGAAATGGCA
  GCCCCCATCAGAACAGGGGACAAGGCACCCACTGTCCCTCTCCCATAAGCCTGCCAAGAAGATTGATGTG
  GCCCGTGTAACGTTTGATCTGTACAAGCTGAACCCACAGGACTTCATTGGCTGCCTGAACGTGAAGGCGA
  CTTTTTATGATACATACTCCCTTTCCTATGATCTGCACTGCTGTGGGGCCAAGCGCATCATGAAGGAAGC
  TTTCCGCTGGGCCCTCTTCAGCATGCAGGCCACAGGCCACGTACTGCTTGGCACCTCCTGTTACCTGCAG
  CAGCTCCTCGATGCTACGGAGGAAGGGCAGCCCCCCAAGGGCAAGGCCTCATCCCTTATCCCGACCTGTC
  TGAAGATACTGCAGTGA
  
  
• Restriction Sites: SgfI-MluI
• ACCN: NM_001199552
• ORF Size: 717 bp
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).

Reference Data

• RefSeq: NM_001199552.1, NP_001186481.1
• RefSeq Size: 1214
• RefSeq ORF: 717
• Locus ID: 63924
• Protein Families: Druggable Genome
• Gene Summary: This gene encodes a member of the cell death-inducing DNA fragmentation factor-like effector family. Members of this family play important roles in apoptosis. The encoded protein promotes lipid droplet formation in adipocytes and may mediate adipocyte apoptosis. This gene is regulated by insulin and its expression is positively correlated with insulin sensitivity. Mutations in this gene may contribute to insulin resistant diabetes. A pseudogene of this gene is located on the short arm of chromosome 3. Alternatively spliced transcript variants that encode different isoforms have been observed for this gene. [provided by RefSeq, Dec 2010]
  Transcript Variant: This variant (4) differs in the 5' UTR and lacks an in-frame portion of the 5' coding region, compared to variant 1. This variant encodes isoform 3, which is shorter than isoform 1. Variants 3 and 4 encode the same protein.