ST20 (NM_001199757) Human Untagged Clone

CAT#: SC329556

ST20 (untagged) - Homo sapiens suppressor of tumorigenicity 20 (ST20), transcript variant 3

Specifications

Product Data

• Type: Human Untagged Clone
• Tag: Tag Free
• Symbol: ST20
• Synonyms: HCCS-1
• Vector: pCMV6 series
• Sequence Data:
  Fully Sequenced ORF

  >NCBI ORF sequence for NM_001199757, the custom clone sequence may differ by one or more nucleotides
  
  
  ATGGCGCGATCTCGGCTCACTGCAACCTCTGTCTCCCAGGTTCAGGAAAATGGCTTTGTAAAGAAGCTTG
  AGCCTAAATCTGGCTGGATGACTTTTCTAGAAGTTACAGGAAAGATCTGTGAAATGCTCTTCTGTCCTGA
  AGCAATACTGTTGACCAGAAAGGACACTCCATATTGTGAAACCGGCCTAATTTTTCTGACTCTTACGAAA
  ACGATTGCCAACACATACTTCTACTTTTAA
  
  
• Restriction Sites: SgfI-MluI
• ACCN: NM_001199757
• ORF Size: 240 bp
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).

Reference Data

• RefSeq: NM_001199757.1, NP_001186686.1
• RefSeq Size: 536
• RefSeq ORF: 240
• Locus ID: 400410