MTHFS (NM_001199758) Human Untagged Clone

CAT#: SC329557

MTHFS (untagged) - Homo sapiens 5,10-methenyltetrahydrofolate synthetase (5-formyltetrahydrofolate cyclo-ligase) (MTHFS), transcript variant 2

Specifications

Product Data

• Type: Human Untagged Clone
• Tag: Tag Free
• Symbol: MTHFS
• Synonyms: HsT19268; NEDMEHM
• Vector: pCMV6 series
• Sequence Data:
  Fully Sequenced ORF

  >NCBI ORF sequence for NM_001199758, the custom clone sequence may differ by one or more nucleotides
  
  
  ATGCAAGATGAAATTGAGACAGAAGAGATCATCAAGGACATTTTCCAACGAGGCAAAATCTGCTTCATCC
  CTCGGTACCGGTTCCAGAGCAATCACATGGATATGGTGAGAATAGAATCACCAGAGGAAATTTCTTTACT
  TCCCAAAACATCCTGGAATATCCCTCAGCCTGGTGAGGGTGATGTTCGGGAGGAGGCCTTGTCCACAGGG
  GGACTTGATCTCATCTTCATGCCAGGCCTTGGGTTTGACAAACATGGCAACCGACTGGGGAGGGGCAAGG
  GCTACTATGATGCCTATCTGAAGCGCTGTTTGCAGCATCAGGAAGTGAAGCCCTACACCCTGGCGTTGGC
  TTTCAAAGAACAGATTTGCCTCCAGGTCCCAGTGAATGAAAACGACATGAAGGTAGATGAAGTCCTTTAC
  GAAGACTCGTCAACAGCTTAA
  
  
• Restriction Sites: SgfI-MluI
• ACCN: NM_001199758
• ORF Size: 441 bp
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).

Reference Data

• RefSeq: NM_001199758.1, NP_001186687.1
• RefSeq Size: 2293
• RefSeq ORF: 441
• Locus ID: 10588
• Protein Pathways: Metabolic pathways, One carbon pool by folate
• Gene Summary: The protein encoded by this gene is an enzyme that catalyzes the conversion of 5-formyltetrahydrofolate to 5,10-methenyltetrahydrofolate, a precursor of reduced folates involved in 1-carbon metabolism. An increased activity of the encoded protein can result in an increased folate turnover rate and folate depletion. Three transcript variants encoding two different isoforms have been found for this gene. [provided by RefSeq, Jun 2011]
  Transcript Variant: This variant (2) differs in the 5' UTR, lacks a portion of the 5' coding region, and initiates translation at a downstream start codon, compared to variant 1. The encoded isoform (b) is shorter than isoform a. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments.