RPL11 (NM_001199802) Human Untagged Clone

CAT#: SC329566

RPL11 (untagged) - Homo sapiens ribosomal protein L11 (RPL11), transcript variant 2

Specifications

Product Data

• Type: Human Untagged Clone
• Tag: Tag Free
• Symbol: RPL11
• Synonyms: DBA7; GIG34; L11; uL5
• Vector: pCMV6 series
• Sequence Data:
  Fully Sequenced ORF

  >NCBI ORF sequence for NM_001199802, the custom clone sequence may differ by one or more nucleotides
  
  
  ATGGCGGATCAAGGTGAAAAGGAGAACCCCATGCGGGAACTTCGCATCCGCAAACTCTGTCTCAACATCT
  GTGTTGGGGAGAGTGGAGACAGACTGACGCGAGCAGCCAAGGTGTTGGAGCAGCTCACAGGGCAGACCCC
  TGTGTTTTCCAAAGCTAGATACACTGTCAGATCCTTTGGCATCCGGAGAAATGAAAAGATTGCTGTCCAC
  TGCACAGTTCGAGGGGCCAAGGCAGAAGAAATCTTGGAGAAGGGTCTAAAGGTGCGGGAGTATGAGTTAA
  GAAAAAACAACTTCTCAGATACTGGAAACTTTGGTTTTGGGATCCAGGAACACATCGATCTGGGTATCAA
  ATATGACCCAAGCATTGGTATCTACGGCCTGGACTTCTATGTGGTGCTGGGTAGGCCAGGTTTCAGCATC
  GCAGACAAGAAGCGCAGGACAGGCTGCATTGGGGCCAAACACAGAATCAGCAAAGAGGAGGCCATGCGCT
  GGTTCCAGCAGAAGTATGATGGGATCATCCTTCCTGGCAAATAA
  
  
• Restriction Sites: SgfI-MluI
• ACCN: NM_001199802
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
• Product Components: The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones.
• Reconstitution: 1. Centrifuge at 5,000xg for 5min.
  2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
  3. Close the tube and incubate for 10 minutes at room temperature.
  4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
  5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.

Reference Data

• RefSeq: NM_001199802.1, NP_001186731.1
• RefSeq Size: 641 bp
• RefSeq ORF: 534 bp
• Locus ID: 6135
• Cytogenetics: 1p36.11
• Protein Pathways: Ribosome
• Gene Summary: 'Ribosomes, the organelles that catalyze protein synthesis, consist of a small 40S subunit and a large 60S subunit. Together these subunits are composed of 4 RNA species and approximately 80 structurally distinct proteins. This gene encodes a ribosomal protein that is a component of the 60S subunit. The protein belongs to the L5P family of ribosomal proteins. It is located in the cytoplasm. The protein probably associates with the 5S rRNA. Alternatively spliced transcript variants encoding different isoforms have been found for this gene. As is typical for genes encoding ribosomal proteins, there are multiple processed pseudogenes of this gene dispersed through the genome. [provided by RefSeq, Dec 2010]'
  Transcript Variant: This variant (2) lacks 3 nts at an alternate splice site, as compared to variant 1. The resulting isoform (2) lacks an internal aa in the N-terminal region, as compared to isoform 1.