GGCT (NM_001199817) Human Untagged Clone
CAT#: SC329571
GGCT (untagged) - Homo sapiens gamma-glutamylcyclotransferase (GGCT), transcript variant 4
"NM_001199817" in other vectors (2)
Product Images
![](https://cdn.origene.com/img/defaults-img-expression-plasmids.jpg)
Other products for "GGCT"
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Symbol | GGCT |
Synonyms | C7orf24; CRF21; GCTG; GGC |
Vector | pCMV6 series |
Sequence Data |
>NCBI ORF sequence for NM_001199817, the custom clone sequence may differ by one or more nucleotides
ATGGCCAACTCGGGCTGCAAGGACGTCACGGGTCCAGATGAGGAGAGTTTTCTGTACTTTGCCTACGGCA GCAACCTGCTGACAGAGAGGATCCACCTCCGAAACCCCTCGGCGGCGTTCTTCTGTGTGGCCCGCCTGCA GATTATTTGCATGGGTGCAAAAGAAAATGGTTTGCCGCTGGAGTATCAAGAGAAGTTAAAAGCAATAGAA CCAAATGACTATACAGGAAAGGTCTCAGAAGAAATTGAAGACATCATCAAAAAGGGGGAAACACAAACTC TTTAG |
Restriction Sites | SgfI-MluI |
ACCN | NM_001199817 |
ORF Size | 285 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
Reference Data | |
RefSeq | NM_001199817.1, NP_001186746.1 |
RefSeq Size | 915 |
RefSeq ORF | 285 |
Locus ID | 79017 |
Protein Pathways | Glutathione metabolism |
Gene Summary | The protein encoded by this gene catalyzes the formation of 5-oxoproline from gamma-glutamyl dipeptides, the penultimate step in glutathione catabolism, and may play a critical role in glutathione homeostasis. The encoded protein may also play a role in cell proliferation, and the expression of this gene is a potential marker for cancer. Pseudogenes of this gene are located on the long arm of chromosome 5 and the short arm of chromosomes 2 and 20. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene. [provided by RefSeq, Dec 2010] Transcript Variant: This variant (4) lacks multiple exons in the coding region but maintains the reading frame, compared to variant 1. This variant encodes isoform 4, which is shorter than isoform 1. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments. |
Documents
Product Manuals |
FAQs |
SDS |
Resources
{0} Product Review(s)
0 Product Review(s)
Submit review
Be the first one to submit a review
Product Citations
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen
complexities in the preparation of your product. International customers may expect an additional 1-2 weeks
in shipping.