DAP3 (NM_001199849) Human Untagged Clone

CAT#: SC329573

DAP3 (untagged) - Homo sapiens death associated protein 3 (DAP3), transcript variant 3


  "NM_001199849" in other vectors (2)

Reconstitution Protocol

USD 400.00

3 Weeks*

Size
    • 10 ug

Product Images

Other products for "DAP3"

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Symbol DAP3
Synonyms bMRP-10; DAP-3; MRP-S29; MRPS29; S29mt
Vector pCMV6 series
Sequence Data
>NCBI ORF sequence for NM_001199849, the custom clone sequence may differ by one or more nucleotides


ATGATGCTGAAAGGAATAACAAGGCTTATCTCTAGGATCCATAAGTTGGACCCTGGGCGTTTTTTACACA
TGGGGACCCAGGCTCGCCAAAGCATTGCTGCTCACCTAGATAACCAGGTTCCAGTTGAGAGTCCGAGAGC
TATTTCCCGCACCAATGAGAATGACCCGGCCAAGCATGGGGATCAGCACGAGGGTCAGCACTACAACATC
TCCCCCCAGGATTTGGAGACTGTATTTCCCCATGGCCTTCCTCCTCGCTTTGTGATGCAGGTGAAGACAT
TCAGTGAAGCTTGCCTGATGGTAAGGAAACCAGCCCTAGAACTTCTGCATTACCTGAAAAACACCAGTTT
TGCTTATCCAGCTATACGATATCTTCTGTATGGAGAGAAGGGAACAGGAAAAACCCTAAGTCTTTGCCAT
GTTATTCATTTCTGTGCAAAACAGGACTGGCTGATACTACATATTCCAGATGCTCATCTTTGGGTGAAAA
ATTGTCGGGATCTTCTGCAGTCCAGCTACAACAAACAGCGCTTTGATCAACCTTTAGAGGCTTCAACCTG
GCTGAAGAATTTCAAAACTACAAATGAGCGCTTCCTGAACCAGATAAAAGTTCAAGAGAAGTATGTCTGG
AATAAGAGAGAAAGCACTGAGAAAGGGAGTCCTCTGGGAGAAGTGGTTGAACAGGGCATAACACGGGTGA
GGAACGCCACAGATGCAGTTGGAATTGTGCTGAAAGAGCTAAAGAGGCAAAGTTCTTTGGGTATGTTTCA
CCTCCTAGTGGCCGTGGATGGAATCAATGCTCTTTGGGGAAGAACCACTCTGAAAAGAGAAGATAAAAGC
CCGATTGCCCCCGAGGAATTAGCACTTGTTCACAACTTGAGGAAAATGATGAAAAATGATTGGCATGGAG
GCGCCATTGTGTCGGCTTTGAGCCAGACTGGGTCTCTCTTTAAGCCCCGGAAAGCCTATCTGCCCCAGGA
GTTGCTGGGAAAGGAAGGATTTGATGCCCTGGATCCCTTTATTCCCATCCTGGTTTCCAACTATAACCCA
AAGGAATTTGAAAGTTGTATTCAGTATTATTTGGAAAACAATTGGCTTCAACATGAGAAAGCTCCTACAG
AAGAAGGGAAAAAAGAGCTGCTGTTCCTAAGTAACGCGAACCCCTCGCTGCTGGAGCGGCACTGTGCCTA
CCTCTAA


Restriction Sites SgfI-MluI     
ACCN NM_001199849
ORF Size 1197 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Reference Data
RefSeq NM_001199849.1, NP_001186778.1
RefSeq Size 2161
RefSeq ORF 1197
Locus ID 7818
Protein Families Druggable Genome
Gene Summary Mammalian mitochondrial ribosomal proteins are encoded by nuclear genes and help in protein synthesis within the mitochondrion. Mitochondrial ribosomes (mitoribosomes) consist of a small 28S subunit and a large 39S subunit. They have an estimated 75% protein to rRNA composition compared to prokaryotic ribosomes, where this ratio is reversed. Another difference between mammalian mitoribosomes and prokaryotic ribosomes is that the latter contain a 5S rRNA. Among different species, the proteins comprising the mitoribosome differ greatly in sequence, and sometimes in biochemical properties, which prevents easy recognition by sequence homology. This gene encodes a 28S subunit protein that also participates in apoptotic pathways which are initiated by tumor necrosis factor-alpha, Fas ligand, and gamma interferon. This protein potentially binds ATP/GTP and might be a functional partner of the mitoribosomal protein S27. Multiple alternatively spliced transcript variants encoding distinct isoforms have been found for this gene. Pseudogenes corresponding to this gene are found on chromosomes 1q and 2q. [provided by RefSeq, Dec 2010]
Transcript Variant: This variant (3) has an additional exon in the 5' UTR, as compared to variant 2. Variants 1, 2 and 3 encode the same isoform (1). Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments.

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.