DAP3 (NM_001199851) Human Untagged Clone

CAT#: SC329575

DAP3 (untagged) - Homo sapiens death associated protein 3 (DAP3), transcript variant 5

Specifications

Product Data

• Type: Human Untagged Clone
• Tag: Tag Free
• Symbol: DAP3
• Synonyms: bMRP-10; DAP-3; MRP-S29; MRPS29; S29mt
• Vector: pCMV6 series
• Sequence Data:
  Fully Sequenced ORF

  >NCBI ORF sequence for NM_001199851, the custom clone sequence may differ by one or more nucleotides
  
  
  ATGATGCTGAAAGGAATAACAAGGCTTATCTCTAGGATCCATAAGGCCAAGCATGGGGATCAGCACGAGG
  GTCAGCACTACAACATCTCCCCCCAGGATTTGGAGACTGTATTTCCCCATGGCCTTCCTCCTCGCTTTGT
  GATGCAGGTGAAGACATTCAGTGAAGCTTGCCTGATGGTAAGGAAACCAGCCCTAGAACTTCTGCATTAC
  CTGAAAAACACCAGTTTTGCTTATCCAGCTATACGATATCTTCTGTATGGAGAGAAGGGAACAGGAAAAA
  CCCTAAGTCTTTGCCATGTTATTCATTTCTGTGCAAAACAGGACTGGCTGATACTACATATTCCAGATGC
  TCATCTTTGGGTGAAAAATTGTCGGGATCTTCTGCAGTCCAGCTACAACAAACAGCGCTTTGATCAACCT
  TTAGAGGCTTCAACCTGGCTGAAGAATTTCAAAACTACAAATGAGCGCTTCCTGAACCAGATAAAAGTTC
  AAGAGAAGTATGTCTGGAATAAGAGAGAAAGCACTGAGAAAGGGAGTCCTCTGGGAGAAGTGGTTGAACA
  GGGCATAACACGGGTGAGGAACGCCACAGATGCAGTTGGAATTGTGCTGAAAGAGCTAAAGAGGCAAAGT
  TCTTTGGGTATGTTTCACCTCCTAGTGGCCGTGGATGGAATCAATGCTCTTTGGGGAAGAACCACTCTGA
  AAAGAGAAGATAAAAGCCCGATTGCCCCCGAGGAATTAGCACTTGTTCACAACTTGAGGAAAATGATGAA
  AAATGATTGGCATGGAGGCGCCATTGTGTCGGCTTTGAGCCAGACTGGGTCTCTCTTTAAGCCCCGGAAA
  GCCTATCTGCCCCAGGAGTTGCTGGGAAAGGAAGGATTTGATGCCCTGGATCCCTTTATTCCCATCCTGG
  TTTCCAACTATAACCCAAAGGAATTTGAAAGTTGTATTCAGTATTATTTGGAAAACAATTGGCTTCAACA
  TGAGAAAGCTCCTACAGAAGAAGGGAAAAAAGAGCTGCTGTTCCTAAGTAACGCGAACCCCTCGCTGCTG
  GAGCGGCACTGTGCCTACCTCTAA
  
  
• Restriction Sites: SgfI-MluI
• ACCN: NM_001199851
• ORF Size: 1074 bp
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).

Reference Data

• RefSeq: NM_001199851.1, NP_001186780.1
• RefSeq Size: 1945
• RefSeq ORF: 1074
• Locus ID: 7818
• Protein Families: Druggable Genome
• Gene Summary: Mammalian mitochondrial ribosomal proteins are encoded by nuclear genes and help in protein synthesis within the mitochondrion. Mitochondrial ribosomes (mitoribosomes) consist of a small 28S subunit and a large 39S subunit. They have an estimated 75% protein to rRNA composition compared to prokaryotic ribosomes, where this ratio is reversed. Another difference between mammalian mitoribosomes and prokaryotic ribosomes is that the latter contain a 5S rRNA. Among different species, the proteins comprising the mitoribosome differ greatly in sequence, and sometimes in biochemical properties, which prevents easy recognition by sequence homology. This gene encodes a 28S subunit protein that also participates in apoptotic pathways which are initiated by tumor necrosis factor-alpha, Fas ligand, and gamma interferon. This protein potentially binds ATP/GTP and might be a functional partner of the mitoribosomal protein S27. Multiple alternatively spliced transcript variants encoding distinct isoforms have been found for this gene. Pseudogenes corresponding to this gene are found on chromosomes 1q and 2q. [provided by RefSeq, Dec 2010]
  Transcript Variant: This variant (5) lacks an in-frame exon in the CDS, as compared to variant 2. The resulting isoform (3) lacks an internal segment, as compared to isoform 1. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments.