NPL (NM_001200050) Human Untagged Clone
CAT#: SC329614
NPL (untagged) - Homo sapiens N-acetylneuraminate pyruvate lyase (dihydrodipicolinate synthase) (NPL), transcript variant 2
"NM_001200050" in other vectors (2)
Product Images
![](https://cdn.origene.com/img/defaults-img-expression-plasmids.jpg)
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Symbol | NPL |
Synonyms | C1orf13; C112; NAL; NPL1 |
Vector | pCMV6 series |
Sequence Data |
>NCBI ORF sequence for NM_001200050, the custom clone sequence may differ by one or more nucleotides
ATGAGCAGGGCCCCCGGGATCCTGGCTTCTTGGAGAAGAGCCCCCTCCCTTTCTGTGCAGAAGGGCAGCC AAACTGCTAGACACACCTGCCACCCAGAGGTTCCGCTGGGAAACTGCTTCTTACCTGTCTACAAGGCCAG TCCCCTCACAGTTACCCGTCTTTGGGCTGAAAGGCTGGATCAGGTGATAATTCACGTAGGAGCACTGAGC TTGAAGGAGTCACAGGAACTGGCCCAACATGCAGCAGAAATAGGAGCTGATGGCATCGCTGTCATTGCAC CGTTCTTCCTCAAGCCATGGACCAAAGATATCCTGATTAATTTCCTAAAGGAAGTGGCTGCTGCCGCCCC TGCCCTGCCATTTTATTACTATCACATTCCTGCCTTGACAGGGGTAAAGATTCGTGCTGAGGAGTTGTTG GATGGGATTCTGGATAAGATCCCCACCTTCCAAGGGCTGAAATTCAGTGATACAGATCTCTTAGACTTCG GGCAATGTGTTGATCAGAATCGCCAGCAACAGTTTGCTTTCCTTTTTGGGGTGGATGAGCAACTGTTGAG TGCTCTGGTGATGGGAGCAACTGGAGCAGTGGGCAGTACCTATAACTACCTGGGAAAAAAGACAAACCAG ATGTTGGAGGCTTTTGAACAAAAGGACTTCTCTTTAGCCCTGAACTATCAGTTTTGTATCCAGAGATTTA TCAACTTTGTTGTCAAACTAGGTTTTGGAGTGTCACAGACCAAAGCCATCATGACTCTGGTCTCTGGGAT TCCAATGGGCCCACCCCGGCTTCCACTGCAGAAAGCCTCCAGGGAGTTTACTGATAGTGCTGAAGCTAAA CTGAAGAGCCTGGATTTCCTTTCTTTCACTGATTTAAAGGATGGAAACTTGGAAGCTGGTAGCTAG |
Restriction Sites | SgfI-MluI |
ACCN | NM_001200050 |
ORF Size | 906 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
Reference Data | |
RefSeq | NM_001200050.1, NP_001186979.1 |
RefSeq Size | 3027 |
RefSeq ORF | 906 |
Locus ID | 80896 |
Protein Pathways | Amino sugar and nucleotide sugar metabolism |
Gene Summary | This gene encodes a member of the N-acetylneuraminate lyase sub-family of (beta/alpha)(8)-barrel enzymes. N-acetylneuraminate lyases regulate cellular concentrations of N-acetyl-neuraminic acid (sialic acid) by mediating the reversible conversion of sialic acid into N-acetylmannosamine and pyruvate. A pseudogene of this gene is located on the short arm of chromosome 2. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene. [provided by RefSeq, Jan 2011] Transcript Variant: This variant (2) differs in the 5' UTR, uses an alternate splice site in the coding region and initiates translation at a downstream start site, compared to variant 1. The encoded isoform (2) is shorter and has a distinct N-terminus, compared to isoform 1. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments. |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC232415 | NPL (Myc-DDK tagged) - Homo sapiens N-acetylneuraminate pyruvate lyase (dihydrodipicolinate synthase) (NPL), transcript variant 2 |
USD 420.00 |
|
RG232415 | NPL (GFP-tagged) - Homo sapiens N-acetylneuraminate pyruvate lyase (dihydrodipicolinate synthase) (NPL), transcript variant 2 |
USD 460.00 |
{0} Product Review(s)
Be the first one to submit a review