Asialoglycoprotein Receptor 2 (ASGR2) (NM_001201352) Human Untagged Clone

CAT#: SC329616

ASGR2 (untagged) - Homo sapiens asialoglycoprotein receptor 2 (ASGR2), transcript variant 4


  "NM_001201352" in other vectors (2)

Reconstitution Protocol

USD 320.00

In Stock*

Size
    • 10 ug

Product Images

Other products for "ASGR2"

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Symbol ASGR2
Synonyms ASGP-R2; ASGPR2; CLEC4H2; HBXBP; HL-2
Vector PCMV6-Neo
E. coli Selection Ampicillin (100 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>NCBI ORF sequence for NM_001201352, the custom clone sequence may differ by one or more nucleotides


ATGGCCAAGGACTTTCAAGATATCCAGCAGCTGAGCTCGGAGGAAAATGACCATCCTTTCCATCAAGGTG
AGGGGCCAGGCACTCGCAGGCTGAATCCCAGGAGAGGAAATCCATTTTTGAAAGGGCCACCTCCTGCCCA
GCCCCTGGCACAGCGTCTCTGCTCCATGGTCTGCTTCAGTCTGCTTGCCCTGAGCTTCAACATCCTGCTG
CTGGTGGTCATCTGTGTGACTGGGTCCCAAAGTGCACAGCTGCAAGCCGAGCTGCGGAGCCTGAAGGAAG
CTTTCAGCAACTTCTCCTCGAGCACCCTGACGGAGGTCCAGGCAATCAGCACCCACGGAGGCAGCGTGGG
TGACAAGATCACATCCCTAGGAGCCAAGCTGGAGAAACAGCAGCAGGACCTGAAAGCAGATCACGATGCC
CTGCTCTTCCATCTGAAGCACTTCCCCGTGGACCTGCGCTTCGTGGCCTGCCAGATGGAGCTCCTCCACA
GCAACGGCTCCCAAAGGACCTGCTGCCCCGTCAACTGGGTGGAGCACCAAGGCAGCTGCTACTGGTTCTC
TCACTCCGGGAAGGCCTGGGCTGAGGCGGAGAAGTACTGCCAGCTGGAGAACGCACACCTGGTGGTCATC
AACTCCTGGGAGGAGCAGAAATTCATTGTACAACACACGAACCCCTTCAATACCTGGATAGGTCTCACGG
ACAGTGATGGCTCTTGGAAATGGGTGGATGGCACAGACTATAGGCACAACTACAAGAACTGGGCTGTCAC
TCAGCCAGATAATTGGCACGGGCACGAGCTGGGTGGAAGTGAAGACTGTGTTGAAGTCCAGCCGGATGGC
CGCTGGAACGATGACTTCTGCCTGCAGGTGTACCGCTGGGTGTGTGAGAAAAGGCGGAATGCCACCGGCG
AGGTGGCCTGA


Restriction Sites SgfI-MluI     
ACCN NM_001201352
OTI Disclaimer Due to the inherent nature of this plasmid, standard methods to replicate additional amounts of DNA in E. coli are highly likely to result in mutations and/or rearrangements. Therefore, OriGene does not guarantee the capability to replicate this plasmid DNA. Additional amounts of DNA can be purchased from OriGene with batch-specific, full-sequence verification at a reduced cost. Please contact our customer care team at custsupport@origene.com or by calling 301.340.3188 option 3 for pricing and delivery.

The molecular sequence of this clone aligns with the gene accession number as a point of reference only. However, individual transcript sequences of the same gene can differ through naturally occurring variations (e.g. polymorphisms), each with its own valid existence. This clone is substantially in agreement with the reference, but a complete review of all prevailing variants is recommended prior to use. More info
Product Components The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones.
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_001201352.1, NP_001188281.1
RefSeq Size 1441 bp
RefSeq ORF 921 bp
Locus ID 433
Cytogenetics 17p13.1
Protein Families Druggable Genome, Transmembrane
Gene Summary 'This gene encodes a subunit of the asialoglycoprotein receptor. This receptor is a transmembrane protein that plays a critical role in serum glycoprotein homeostasis by mediating the endocytosis and lysosomal degradation of glycoproteins with exposed terminal galactose or N-acetylgalactosamine residues. The asialoglycoprotein receptor may facilitate hepatic infection by multiple viruses including hepatitis B, and is also a target for liver-specific drug delivery. The asialoglycoprotein receptor is a hetero-oligomeric protein composed of major and minor subunits, which are encoded by different genes. The protein encoded by this gene is the less abundant minor subunit. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene. [provided by RefSeq, Jan 2011]'
Transcript Variant: This variant (4), also known as H2b, differs in the 5' UTR and uses an alternate splice site in the 5' coding region, but maintains the reading frame, compared to variant H2'. The encoded isoform (d) is shorter than isoform a.

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.