Nucleotide binding protein like (NUBPL) (NM_001201573) Human Untagged Clone

CAT#: SC329638

NUBPL (untagged) - Homo sapiens nucleotide binding protein-like (NUBPL), transcript variant 2

Specifications

Product Data

• Type: Human Untagged Clone
• Tag: Tag Free
• Symbol: NUBPL
• Synonyms: C14orf127; huInd1; IND1; MC1DN21
• Vector: pCMV6 series
• Sequence Data:
  Fully Sequenced ORF

  >NCBI ORF sequence for NM_001201573, the custom clone sequence may differ by one or more nucleotides
  
  
  ATGTCCAAGGCCATTGGTTTGCTAGATGTGGATGTGTATGGACCTTCAGTTCCAAAGATGATGAATCTGA
  AAGGAAATCCGGAATTATCACAGAGCAACCTAATGAGGCCTCTCTTGAATTATGGTATTGCTTGTATGTC
  TATGGGCTTTCTGGTTGAAGAAAGTGAACCAGTAGTTTGGAGAGGCCTTATGGTAATGTCGGCCATTGAG
  AAATTGTTGAGGCAGGTAGATTGGGGTCAACTGGACTACTTAGTTGTAGACATGCCACCAGGAACTGGAG
  ATGTGCAGTTATCAGTCTCACAGAATATTCCTATAACAGGTGCTGTGATTGTCTCCACGCCCCAGGACAT
  CGCATTGATGGATGCACACAAGGGTGCTGAGATGTTTCGCAGAGTCCACGTGCCCGTCCTTGGCCTTGTC
  CAAAACATGAGTGTTTTCCAGTGTCCAAAATGTAAACACAAAACTCATATTTTTGGTGCTGATGGTGCAA
  GGAAACTAGCACAGACCCTTGGTCTTGAAGTTCTAGGAGACATTCCCTTACACCTTAATATAAGGGAAGC
  TTCAGATACAGGCCAGCCAATTGTGTTTTCACAGCCTGAAAGTGATGAGGCCAAAGCTTACTTGAGGATT
  GCTGTGGAAGTGGTAAGAAGATTGCCATCACCTTCAGAATGA
  
  
• Restriction Sites: SgfI-MluI
• ACCN: NM_001201573
• ORF Size: 672 bp
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).

Reference Data

• RefSeq: NM_001201573.1, NP_001188502.1
• RefSeq Size: 2836
• RefSeq ORF: 672
• Locus ID: 80224
• Gene Summary: This gene encodes a member of the Mrp/NBP35 ATP-binding proteins family. The encoded protein is required for the assembly of the respiratory chain NADH dehydrogenase (complex I), an oligomeric enzymatic complex located in the inner mitochondrial membrane. Mutations in this gene cause mitochondrial complex I deficiency. Alternative splicing results in multiple transcript variants. [provided by RefSeq, May 2014]
  Transcript Variant: This variant (2) lacks two exons from the 5' end and has an alternate 5' exon, as compared to variant 1. The resulting isoform (2) has a shorter N-terminus, as compared to isoform 1. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments.