Nucleotide binding protein like (NUBPL) (NM_001201574) Human Untagged Clone

CAT#: SC329639

NUBPL (untagged) - Homo sapiens nucleotide binding protein-like (NUBPL), transcript variant 3


  "NM_001201574" in other vectors (2)

Reconstitution Protocol

USD 310.00

3 Weeks*

Size
    • 10 ug

Product Images

Other products for "NUBPL"

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Symbol NUBPL
Synonyms C14orf127; huInd1; IND1; MC1DN21
Vector pCMV6 series
Sequence Data
>NCBI ORF sequence for NM_001201574, the custom clone sequence may differ by one or more nucleotides


ATGCCACCAGGAACTGGAGATGTGCAGTTATCAGTCTCACAGAATATTCCTATAACAGGTGCTGTGATTG
TCTCCACGCCCCAGGACATCGCATTGATGGATGCACACAAGGGTGCTGAGATGTTTCGCAGAGTCCACGT
GCCCGTCCTTGGCCTTGTCCAAAACATGAGTGTTTTCCAGTGTCCAAAATGTAAACACAAAACTCATATT
TTTGGTGCTGATGGTGCAAGGAAACTAGCACAGACCCTTGGTCTTGAAGTTCTAGGAGACATTCCCTTAC
ACCTTAATATAAGGGAAGCTTCAGATACAGGCCAGCCAATTGTGTTTTCACAGCCTGAAAGTGATGAGGC
CAAAGCTTACTTGAGGATTGCTGTGGAAGTGGTAAGAAGATTGCCATCACCTTCAGAATGA


Restriction Sites SgfI-MluI     
ACCN NM_001201574
ORF Size 411 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Reference Data
RefSeq NM_001201574.1, NP_001188503.1
RefSeq Size 2739
RefSeq ORF 411
Locus ID 80224
Gene Summary This gene encodes a member of the Mrp/NBP35 ATP-binding proteins family. The encoded protein is required for the assembly of the respiratory chain NADH dehydrogenase (complex I), an oligomeric enzymatic complex located in the inner mitochondrial membrane. Mutations in this gene cause mitochondrial complex I deficiency. Alternative splicing results in multiple transcript variants. [provided by RefSeq, May 2014]
Transcript Variant: This variant (3) lacks several exons from the 5' end and has an alternate 5' exon, as compared to variant 1. The resulting isoform (3) has a much shorter N-terminus, as compared to isoform 1. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments.

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.