Peroxiredoxin 1 (PRDX1) (NM_001202431) Human Untagged Clone

CAT#: SC329653

PRDX1 (untagged) - Homo sapiens peroxiredoxin 1 (PRDX1), transcript variant 4


  "NM_001202431" in other vectors (2)

Reconstitution Protocol

USD 310.00

3 Weeks*

Size
    • 10 ug

Product Images

Other products for "PRDX1"

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Symbol PRDX1
Synonyms MSP23; NKEF-A; NKEFA; PAG; PAGA; PAGB; PRX1; PRXI; TDPX2
Vector pCMV6 series
Sequence Data
>NCBI ORF sequence for NM_001202431, the custom clone sequence may differ by one or more nucleotides


ATGTCTTCAGGAAATGCTAAAATTGGGCACCCTGCCCCCAACTTCAAAGCCACAGCTGTTATGCCAGATG
GTCAGTTTAAAGATATCAGCCTGTCTGACTACAAAGGAAAATATGTTGTGTTCTTCTTTTACCCTCTTGA
CTTCACCTTTGTGTGCCCCACGGAGATCATTGCTTTCAGTGATAGGGCAGAAGAATTTAAGAAACTCAAC
TGCCAAGTGATTGGTGCTTCTGTGGATTCTCACTTCTGTCATCTAGCATGGGTCAATACACCTAAGAAAC
AAGGAGGACTGGGACCCATGAACATTCCTTTGGTATCAGACCCGAAGCGCACCATTGCTCAGGATTATGG
GGTCTTAAAGGCTGATGAAGGCATCTCGTTCAGGGGCCTTTTTATCATTGATGATAAGGGTATTCTTCGG
CAGATCACTGTAAATGACCTCCCTGTTGGCCGCTCTGTGGATGAGACTTTGAGACTAGTTCAGGCCTTCC
AGTTCACTGACAAACATGGGGAAGTGTGCCCAGCTGGCTGGAAACCTGGCAGTGATACCATCAAGCCTGA
TGTCCAAAAGAGCAAAGAATATTTCTCCAAGCAGAAGTGA


Restriction Sites SgfI-MluI     
ACCN NM_001202431
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones.
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_001202431.1, NP_001189360.1
RefSeq Size 1046 bp
RefSeq ORF 600 bp
Locus ID 5052
Cytogenetics 1p34.1
Gene Summary 'This gene encodes a member of the peroxiredoxin family of antioxidant enzymes, which reduce hydrogen peroxide and alkyl hydroperoxides. The encoded protein may play an antioxidant protective role in cells, and may contribute to the antiviral activity of CD8(+) T-cells. This protein may have a proliferative effect and play a role in cancer development or progression. Four transcript variants encoding the same protein have been identified for this gene. [provided by RefSeq, Jan 2011]'
Transcript Variant: This variant (4) contains a different exon for part of its 5' UTR, compared to variant 1. All four variants encode the same protein.

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.