UBE2G2 (NM_001202489) Human Untagged Clone

CAT#: SC329664

UBE2G2 (untagged) - Homo sapiens ubiquitin-conjugating enzyme E2G 2 (UBE2G2), transcript variant 3

Specifications

Product Data

• Type: Human Untagged Clone
• Tag: Tag Free
• Symbol: UBE2G2
• Synonyms: UBC7
• Vector: pCMV6 series
• Sequence Data:
  Fully Sequenced ORF

  >NCBI ORF sequence for NM_001202489, the custom clone sequence may differ by one or more nucleotides
  
  
  ATGAGATTTACCTGTGAGATGTTTCATCCCAACATCTACCCTGATGGGAGAGTCTGCATTTCCATCCTCC
  ACGCGCCAGGCGATGACCCCATGGGCTACGAGAGCAGCGCGGAGCGGTGGAGTCCTGTGCAGAGTGTGGA
  GAAGATCCTGCTGTCGGTGGTGAGCATGCTGGCAGAGCCCAATGACGAAAGTGGAGCTAACGTGGATGCG
  TCCAAAATGTGGCGCGATGACCGGGAGCAGTTCTATAAGATTGCCAAGCAGATCGTCCAGAAGTCTCTGG
  GACTGTGA
  
  
• Restriction Sites: SgfI-MluI
• ACCN: NM_001202489
• ORF Size: 288 bp
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).

Reference Data

• RefSeq: NM_001202489.1, NP_001189418.1
• RefSeq Size: 3318
• RefSeq ORF: 288
• Locus ID: 7327
• Protein Families: Druggable Genome
• Protein Pathways: Parkinson's disease, Ubiquitin mediated proteolysis
• Gene Summary: The modification of proteins with ubiquitin is an important cellular mechanism for targeting abnormal or short-lived proteins for degradation. Ubiquitination involves at least three classes of enzymes: ubiquitin-activating enzymes, or E1s, ubiquitin-conjugating enzymes, or E2s, and ubiquitin-protein ligases, or E3s. This gene encodes a member of the E2 ubiquitin-conjugating enzyme family. The encoded protein shares 100% sequence identity with the mouse counterpart. This gene is ubiquitously expressed, with high expression seen in adult muscle. Three alternatively spliced transcript variants encoding distinct isoforms have been found for this gene. [provided by RefSeq, Jan 2011]
  Transcript Variant: This variant (3) lacks an exon in the 5' region, resulting in a downstream AUG start codon, as compared to variant 1. The resulting isoform (3) has a shorter N-terminus, as compared to isoform 1. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments.