TL1A (TNFSF15) (NM_001204344) Human Untagged Clone

CAT#: SC329737

TNFSF15 (untagged) - Homo sapiens tumor necrosis factor (ligand) superfamily, member 15 (TNFSF15), transcript variant 2

Specifications

Product Data

• Type: Human Untagged Clone
• Tag: Tag Free
• Symbol: TNFSF15
• Synonyms: TL1; TL1A; TNLG1B; VEGI; VEGI192A
• Vector: pCMV6-Entry
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Sequence Data:
  Fully Sequenced ORF

  >NCBI ORF sequence for NM_001204344, the custom clone sequence may differ by one or more nucleotides
  
  
  ATGCAACTCACAAAGGGCCGTCTTCATTTCAGTCACCCTTTGTCTCATACAAAGCACATTTCTCCTTTTG
  TTACAGATGCACCTCTTAGAGCAGACGGAGATAAGCCAAGGGCACACCTGACAGTTGTGAGACAAACTCC
  CACACAGCACTTTAAAAATCAGTTCCCAGCTCTGCACTGGGAACATGAACTAGGCCTGGCCTTCACCAAG
  AACCGAATGAACTATACCAACAAATTCCTGCTGATCCCAGAGTCGGGAGACTACTTCATTTACTCCCAGG
  TCACATTCCGTGGGATGACCTCTGAGTGCAGTGAAATCAGACAAGCAGGCCGACCAAACAAGCCAGACTC
  CATCACTGTGGTCATCACCAAGGTAACAGACAGCTACCCTGAGCCAACCCAGCTCCTCATGGGGACCAAG
  TCTGTATGCGAAGTAGGTAGCAACTGGTTCCAGCCCATCTACCTCGGAGCCATGTTCTCCTTGCAAGAAG
  GGGACAAGCTAATGGTGAACGTCAGTGACATCTCTTTGGTGGATTACACAAAAGAAGATAAAACCTTCTT
  TGGAGCCTTCTTACTATAG
  
  
• Restriction Sites: SgfI-MluI
• ACCN: NM_001204344
• ORF Size: 579 bp
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).

Reference Data

• RefSeq: NM_001204344.1, NP_001191273.1
• RefSeq Size: 6412
• RefSeq ORF: 579
• Locus ID: 9966
• Protein Families: Druggable Genome, Transmembrane
• Protein Pathways: Cytokine-cytokine receptor interaction
• Gene Summary: The protein encoded by this gene is a cytokine that belongs to the tumor necrosis factor (TNF) ligand family. This protein is abundantly expressed in endothelial cells, but is not expressed in either B or T cells. The expression of this protein is inducible by TNF and IL-1 alpha. This cytokine is a ligand for receptor TNFRSF25 and decoy receptor TNFRSF21/DR6. It can activate NF-kappaB and MAP kinases, and acts as an autocrine factor to induce apoptosis in endothelial cells. This cytokine is also found to inhibit endothelial cell proliferation, and thus may function as an angiogenesis inhibitor. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Feb 2011]
  Transcript Variant: This variant (2) differs in the 5' UTR and coding sequence compared to variant 1. The resulting isoform (VEGI-192) has a shorter and distinct N-terminus compared to isoform VEGI-251. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments.