LIMS4 (NM_001205288) Human Untagged Clone

CAT#: SC329801

LIMS3L (untagged) - Homo sapiens LIM and senescent cell antigen-like domains 3-like (LIMS3L), transcript variant 1


  "NM_001205288" in other vectors (2)

Reconstitution Protocol

USD 310.00

3 Weeks*

Size
    • 10 ug

Product Images

Other products for "LIMS4"

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Symbol LIMS4
Synonyms LIMS3L
Vector pCMV6 series
Sequence Data
>NCBI ORF sequence for NM_001205288, the custom clone sequence may differ by one or more nucleotides


ATGGCCTTCTCAGGCCGAGCGCGCCCCTGCATTATCCCAGAGAACGAAGAAATCCCCCGAGCAGCCCTTA
ACACTGTCCACGAGGCCAATGGGACCGAGGACGAGAGGGCTGTTTCCAAACTGCAGCGCAGGCACAGTGA
CGTGAAAGTCTACAAGGAGTTCTGTGACTTTTATGCGAAATTCAACATGGCCAACGCCCTGGCCAGCGCC
ACTTGCGAGCGCTGCAAGGGCGGCTTTGCGCCCGCTGAGACGATCGTGAACAGTAATGGGGAGCTGTACC
ATGAGCAGTGTTTCGTGTGCGCTCAGTGCTTCCAGCAGTTCCCAGAAGGACTCTTCTATGAGGAACGAAC
GTGA


Restriction Sites SgfI-MluI     
ACCN NM_001205288
ORF Size 354 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Reference Data
RefSeq NM_001205288.1, NP_001192217.1
RefSeq Size 1221
RefSeq ORF 354
Locus ID 100288695

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.