RASSF1 (NM_001206957) Human Untagged Clone

CAT#: SC329866

RASSF1 (untagged) - Homo sapiens Ras association (RalGDS/AF-6) domain family member 1 (RASSF1), transcript variant H

Specifications

Product Data

• Type: Human Untagged Clone
• Tag: Tag Free
• Symbol: RASSF1
• Synonyms: 123F2; NORE2A; RASSF1A; RDA32; REH3P21
• Vector: pCMV6 series
• Sequence Data:
  Fully Sequenced ORF

  >NCBI ORF sequence for NM_001206957, the custom clone sequence may differ by one or more nucleotides
  
  
  ATGAGCTTGAACAAGGACGGTTCTTACACAGGCTTCATCAAGGTTCAGCTGAAGCTGGTGCGCCCTGTCT
  CTGTGCCCTCCAGCAAGAAGCCACCCTCCTTGCAGGATGCCCGGCGGGGCCCAGGACGGGGCACAAGTGT
  CAGGCGCCGCACTTCCTTTTACCTGCCCAAGGATGCTGTCAAGCACCTGCATGTGCTGTCACGCACAAGG
  GCACGTGAAGTCATTGAGGCCCTGCTGCGAAAGTTCTTGGTGGTGGATGACCCCCGCAAGTTTGCACTCT
  TTGAGCGCGCTGAGCGTCACGGCCAAGTGTACTTGCGGAAGCTGTTGGATGATGAGCAGCCCCTGCGGCT
  GCGGCTCCTGGCAGGGCCCAGTGACAAGGCCCTGAGCTTTGTCCTGAAGGAAAATGACTCTGGGGAGGTG
  AACTGGGACGCCTTCAGCATGCCTGAACTACATAACTTCCTACGTATCCTGCAGCGGGAGGAGGAGGAGC
  ACCTCCGCCAGATCCTGCAGAAGTACTCCTATTGCCGCCAGAAGATCCAAGAGGCCCTGCACGCCTGCCC
  CCTTGGGTGA
  
  
• Restriction Sites: SgfI-MluI
• ACCN: NM_001206957
• ORF Size: 570 bp
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).

Reference Data

• RefSeq: NM_001206957.1, NP_001193886.1
• RefSeq Size: 1859
• RefSeq ORF: 570
• Locus ID: 11186
• Protein Families: Druggable Genome
• Protein Pathways: Bladder cancer, Non-small cell lung cancer, Pathways in cancer
• Gene Summary: This gene encodes a protein similar to the RAS effector proteins. Loss or altered expression of this gene has been associated with the pathogenesis of a variety of cancers, which suggests the tumor suppressor function of this gene. The inactivation of this gene was found to be correlated with the hypermethylation of its CpG-island promoter region. The encoded protein was found to interact with DNA repair protein XPA. The protein was also shown to inhibit the accumulation of cyclin D1, and thus induce cell cycle arrest. Several alternatively spliced transcript variants of this gene encoding distinct isoforms have been reported. [provided by RefSeq, May 2011]
  Transcript Variant: This variant (H) lacks an alternate coding exon compared to variant D, that causes a frameshift. The resulting isoform (B) is shorter at the N-terminus compared to isoform D. Variants B and H both encode the same isoform (B).