UGT2B28 (NM_001207004) Human Untagged Clone

CAT#: SC329882

UGT2B28 (untagged) - Homo sapiens UDP glucuronosyltransferase 2 family, polypeptide B28 (UGT2B28), transcript variant 2


  "NM_001207004" in other vectors (2)

Reconstitution Protocol

USD 340.00

3 Weeks*

Size
    • 10 ug

Product Images

Other products for "UGT2B28"

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Symbol UGT2B28
Vector pCMV6 series
Sequence Data
>NCBI ORF sequence for NM_001207004, the custom clone sequence may differ by one or more nucleotides


ATGGCTCTGAAGTGGACTTCAGTTCTTCTGCTGATACATCTCGGTTGTTACTTTAGCTCTGGGAGTTGTG
GAAAGGTGCTGGTGTGGACCGGTGAATACAGCCATTGGATGAATATGAAGACAATCCTGAAAGAGCTTGT
TCAGAGAGGTCATGAGGTGACTGTACTGGCATCTTCAGCTTCCATTCTTTTTGATCCCAATGACGCATTC
ACTCTTAAACTCGAAGTTTATCCTACATCTTTAACTAAAACTGAATTTGAGAATATCATCATGCAACAGG
TTAAGAGATGGTCAGACATTCAAAAAGATAGCTTTTGGTTATATTTTTCACAAGAACAAGAAATCCTGTG
GGAATTTCATGACATATTTAGAAACTTCTGTAAAGATGTAGTTTCAAATAAGAAAGTTATGAAAAAACTA
CAAGAGTCAAGATTTGACATCATTTTTGCAGATGCTTTTTTTCCTTGTGGTGAGCTGCTGGCTGCGCTAC
TTAACATACCGTTTGTGTACAGTCTCTGCTTCACTCCTGGCTACACAATTGAAAGGCACAGTGGAGGACT
GATTTTCCCTCCTTCCTACATACCTGTTGTTATGTCAAAATTAAGTGATCAAATGACTTTCATGGAGAGG
GTAAAAAACATGATCTATGTGCTTTATTTTGACTTTTGGTTCCAAATGTGTGATATGAAGAAGTGGGATC
AGTTTTACAGTGAAGTTTTAGGAAGACCCACTACCTTATTTGAGACAATGGGGAAAGCTGACATATGGCT
TATGCGAAACTCCTGGAGTTTTCAATTTCCTCATCCATTCTTACCAAACATTGATTTTGTTGGAGGACTC
CACTGCAAACCTGCCAAACCCCTACCTAAGGAAATGGAGGAATTTGTACAGAGCTCTGGTGAAAATGGTG
TTGTGGTGTTTTCTCTGGGGTCAGTGATAAGTAACATGACAGCAGAAAGGGCCAACGTAATTGCAACAGC
CCTTGCCAAGATCCCACAAAAGATATAA


Restriction Sites SgfI-MluI     
ACCN NM_001207004
ORF Size 1008 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Reference Data
RefSeq NM_001207004.1, NP_001193933.1
RefSeq Size 1543
RefSeq ORF 1008
Locus ID 54490
Protein Families Transmembrane
Protein Pathways Androgen and estrogen metabolism, Ascorbate and aldarate metabolism, Drug metabolism - cytochrome P450, Drug metabolism - other enzymes, Metabolic pathways, Metabolism of xenobiotics by cytochrome P450, Pentose and glucuronate interconversions, Porphyrin and chlorophyll metabolism, Retinol metabolism, Starch and sucrose metabolism
Gene Summary This gene encodes a member of the uridine diphosphoglucuronosyltransferase protein family. The encoded enzyme catalyzes the transfer of glucuronic acid from uridine diphosphoglucuronic acid to a diverse array of substrates including steroid hormones and lipid-soluble drugs. This process, known as glucuronidation, is an intermediate step in the metabolism of steroids. Two transcript variants encoding different isoforms have been found for this gene. While both isoforms are targeted to the endoplasmic reticulum, only the longer isoform appears to be active. [provided by RefSeq, May 2011]
Transcript Variant: This variant (2) lacks two coding exons compared to variant 1, that causes a frameshift.The resulting isoform (2) has a shorter and distinct C-terminus compared to isoform 1.

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.