EDA2R (NM_001242310) Human Untagged Clone
CAT#: SC329918
EDA2R (untagged) - Homo sapiens ectodysplasin A2 receptor (EDA2R), transcript variant 3
"NM_001242310" in other vectors (2)
Product Images
![](https://cdn.origene.com/img/defaults-img-expression-plasmids.jpg)
Other products for "EDA2R"
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Symbol | EDA2R |
Synonyms | EDA-A2R; EDAA2R; TNFRSF27; XEDAR |
Vector | pCMV6 series |
Sequence Data |
>NCBI ORF sequence for NM_001242310, the custom clone sequence may differ by one or more nucleotides
ATGGATTGCCAAGAAAATGAGTACTGGGACCAATGGGGACGGTGTGTCACCTGCCAACGGTGTGGTCCTG GACAGGAGCTATCCAAGGATTGTGGTTATGGAGAGGGTGGAGATGCCTACTGCACAGCCTGCCCTCCTCG CAGGTACAAAAGCAGCTGGGGCCACCACAGATGTCAGAGTTGCATCACCTGTGCTGTCATCAATCGTGTT CAGAAGGTCAACTGCACAGCTACCTCTAATGCTGTCTGTGGGGACTGTTTGCCCAGGTTCTACCGAAAGA CACGCATTGGAGGCCTGCAGGACCAAGAGTGCATCCCGTGCACGAAGCAGACCCCCACCTCTGAGGTTCA ATGTGCCTTCCAGTTGAGCTTAGTGGAGGCAGATGCACCCACAGTGCCCCCTCAGGAGGCCACACTTGTT GCACTGGTGAGCAGCCTGCTAGTGGTGTTTACCCTGGCCTTCCTGGGGCTCTTCTTCCTCTACTGCAAGC AGTTCTTCAACAGACATTGCCAGCGTGAGAAATTGATTATTTTCTCTGATCCAGTACCAGCTAGCCTCAA TCTGATACCTGAATTTGCAGGAGGTTTGCTGCAGTTTGAGGCTGATAAAACAGCAAAGGAGGAATCTCTC TTCCCCGTGCCACCCAGCAAGGAGACCAGTGCTGAGTCCCAAGTGAGTGAGAACATCTTTCAGACCCAGC CACTTAACCCTATCCTCGAGGACGACTGCAGCTCGACTAGTGGCTTCCCCACACAGGAGTCCTTTACCAT GGCCTCCTGCACCTCAGAGAGCCACTCCCACTGGGTCCACAGCCCCATCGAATGCACAGAGCTGGACCTG CAAAAGTTTTCCAGCTCTGCCTCCTATACTGGAGCTGAGACCTTGGGGGGAAACACAGTCGAAAGCACTG GAGACAGGCTGGAGCTCAATGTGCCCTTTGAAGTTCCCAGCCCTTAA |
Restriction Sites | SgfI-MluI |
ACCN | NM_001242310 |
ORF Size | 957 bp |
OTI Disclaimer | Due to the inherent nature of this plasmid, standard methods to replicate additional amounts of DNA in E. coli are highly likely to result in mutations and/or rearrangements. Therefore, OriGene does not guarantee the capability to replicate this plasmid DNA. Additional amounts of DNA can be purchased from OriGene with batch-specific, full-sequence verification at a reduced cost. Please contact our customer care team at custsupport@origene.com or by calling 301.340.3188 option 3 for pricing and delivery. The molecular sequence of this clone aligns with the gene accession number as a point of reference only. However, individual transcript sequences of the same gene can differ through naturally occurring variations (e.g. polymorphisms), each with its own valid existence. This clone is substantially in agreement with the reference, but a complete review of all prevailing variants is recommended prior to use. More info |
Reference Data | |
RefSeq | NM_001242310.1, NP_001229239.1 |
RefSeq Size | 3434 |
RefSeq ORF | 957 |
Locus ID | 60401 |
Protein Families | Druggable Genome, Transcription Factors, Transmembrane |
Protein Pathways | Cytokine-cytokine receptor interaction |
Gene Summary | The protein encoded by this gene is a type III transmembrane protein of the TNFR (tumor necrosis factor receptor) superfamily, and contains cysteine-rich repeats and a single transmembrane domain. This protein binds to the EDA-A2 isoform of ectodysplasin, which plays an important role in maintenance of hair and teeth. Alternatively spliced transcript variants encodes distinct protein isoforms. [provided by RefSeq, Apr 2016] |
Documents
Product Manuals |
FAQs |
SDS |
Resources
{0} Product Review(s)
0 Product Review(s)
Submit review
Be the first one to submit a review
Product Citations
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen
complexities in the preparation of your product. International customers may expect an additional 1-2 weeks
in shipping.