DIO2 (NM_001242502) Human Untagged Clone
CAT#: SC329975
DIO2 (untagged) - Homo sapiens deiodinase, iodothyronine, type II (DIO2), transcript variant 4
"NM_001242502" in other vectors (2)
Product Images
![](https://cdn.origene.com/img/defaults-img-expression-plasmids.jpg)
Other products for "DIO2"
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Symbol | DIO2 |
Synonyms | 5DII; D2; DIOII; SelY; TXDI2 |
Vector | pCMV6 series |
Sequence Data |
>NCBI ORF sequence for NM_001242502, the custom clone sequence may differ by one or more nucleotides
ATGGGCATCCTCAGCGTAGACTTGCTGATCACACTGCAAATTCTGCCAGTTTTTTTCTCCAACTGCCTCT TCCTGGCTCTCTATGACTCGGTCATTCTGCTCAAGCACGTGGTGCTGCTGTTGAGCCGCTCCAAGTCCAC TCGCGGAGAGTGGCGGCGCATGCTGACCTCAGAGGGACTGCGCTGCGTCTGGAAGAGCTTCCTCCTCGAT GCCTACAAACAGCTAAATTGTCCTCCATCAGGTTTTAGCAAAGATGGACACATTTTATGACTAGTATATG AAGCTTATAAAAGCAGACTACTGGTCTACTCACATTTGGATTTATGGATGACTGACAGTGTTGTACTTAC TCTAAATTTCCCAAGGCAAATTAGTCTGTGTTTTGGAAAGAATTCTGCAGCTGAACTATACATTGTTTCT AAGAAGGAGAAGGTGCCTTAA |
Restriction Sites | SgfI-MluI |
ACCN | NM_001242502 |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
Product Components | The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones. |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Reference Data | |
RefSeq | NM_001242502.1, NP_001229431.1 |
RefSeq Size | 6284 bp |
RefSeq ORF | 441 bp |
Locus ID | 1734 |
Cytogenetics | 14q31.1 |
Protein Families | Druggable Genome |
Gene Summary | 'The protein encoded by this gene belongs to the iodothyronine deiodinase family. It catalyzes the conversion of prohormone thyroxine (3,5,3',5'-tetraiodothyronine, T4) to the bioactive thyroid hormone (3,5,3'-triiodothyronine, T3) by outer ring 5'-deiodination. This gene is widely expressed, including in thyroid and brain. It is thought to be responsible for the 'local' production of T3, and thus important in influencing thyroid hormone action in these tissues. It has also been reported to be highly expressed in thyroids of patients with Graves disease, and in follicular adenomas. The intrathyroidal T4 to T3 conversion by this enzyme may contribute significantly to the relative increase in thyroidal T3 production in these patients. This protein is a selenoprotein containing the non-standard amino acid, selenocysteine (Sec), which is encoded by the UGA codon that normally signals translation termination. The 3' UTRs of selenoprotein mRNAs contain a conserved stem-loop structure, designated the Sec insertion sequence (SECIS) element, that is necessary for the recognition of UGA as a Sec codon, rather than as a stop signal. Unlike the other two members (DIO1 and DIO3) of this enzyme family, the mRNA for this gene contains an additional in-frame UGA codon that has been reported (in human) to function either as a Sec or a stop codon, which can result in two isoforms with one or two Sec residues; however, only the upstream Sec (conserved with the single Sec residue found at the active site in DIO1 and DIO3) was shown to be essential for enzyme activity (PMID:10403186). Alternatively spliced transcript variants have been described for this gene. [provided by RefSeq, Oct 2018]' Transcript Variant: This variant (4, also known as hDII-c) includes two novel exons in the coding region, with the latter causing a frameshift compared to variant 1. The resulting isoform (c) is shorter with a distinct C-terminus compared to isoform a. |
Documents
Product Manuals |
FAQs |
Resources
{0} Product Review(s)
0 Product Review(s)
Submit review
Be the first one to submit a review
Product Citations
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen
complexities in the preparation of your product. International customers may expect an additional 1-2 weeks
in shipping.