TMEM139 (NM_001242776) Human Untagged Clone
CAT#: SC330010
TMEM139 (untagged) - Homo sapiens transmembrane protein 139 (TMEM139), transcript variant 5
"NM_001242776" in other vectors (2)
Product Images
![](https://cdn.origene.com/img/defaults-img-expression-plasmids.jpg)
Other products for "TMEM139"
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Symbol | TMEM139 |
Synonyms | FLJ90586 |
Vector | pCMV6 series |
Sequence Data |
>NCBI ORF sequence for NM_001242776, the custom clone sequence may differ by one or more nucleotides
ATGGCCTCAGAGGGGTCCATGGCCCAGGAAGGAAGCCCTGGAAGAGCTCCAATCAACCTTCGGCTTCGGG GACCACGGGCTGTGTCCACTGCTCCTGATCTGCAGAGCTTGGCGGCAGTCCCCACATTAGAGCCTCTGAC TCCACCCCCTGCCTATGATGTCTGCTTTGGTCACCCTGATGATGATAGTGTTTTTTATGAGGACAACTGG GCACCCCCTTAA |
Restriction Sites | SgfI-MluI |
ACCN | NM_001242776 |
ORF Size | 222 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
Reference Data | |
RefSeq | NM_001242776.1, NP_001229705.1 |
RefSeq Size | 1791 |
RefSeq ORF | 222 |
Locus ID | 135932 |
Protein Families | Transmembrane |
Documents
Product Manuals |
FAQs |
SDS |
Resources
{0} Product Review(s)
0 Product Review(s)
Submit review
Be the first one to submit a review
Product Citations
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen
complexities in the preparation of your product. International customers may expect an additional 1-2 weeks
in shipping.