SIRT5 (NM_001242827) Human Untagged Clone

CAT#: SC330023

SIRT5 (untagged) - Homo sapiens sirtuin 5 (SIRT5), transcript variant 4

Specifications

Product Data

• Type: Human Untagged Clone
• Tag: Tag Free
• Symbol: SIRT5
• Synonyms: SIR2L5
• Vector: pCMV6 series
• Sequence Data:
  Fully Sequenced ORF

  >NCBI ORF sequence for NM_001242827, the custom clone sequence may differ by one or more nucleotides
  
  
  ATGGGGAGCAAGGAGCCCAACGCCGGGCACCGCGCCATAGCCGAGTGTGAGACCCGGCTGGGCAAGCAGG
  GCCGGCGAGTCGTGGTCATCACCCAGAACATCGATGAGCTGCACCGCAAGGCTGGCACCAAGAACCTTCT
  GGAGATCCATGGTAGCTTATTTAAAACTCGATGTACCTCTTGTGGAGTTGTGGCTGAGAATTACAAGAGT
  CCAATTTGTCCAGCTTTATCAGGAAAAGGTGCTCCAGAACCTGGAACTCAAGATGCCAGCATCCCAGTTG
  AGAAACTTCCCCGGTGTGAAGAGGCAGGCTGCGGGGGCTTGCTGCGACCTCACGTCGTGTGGTTTGGAGA
  AAACCTGGATCCTGCCATTCTGGAGGAGGTTGACAGAGAGCTCGCCCACTGTGATTTATGTCTAGTGGTG
  GGCACTTCCTCTGTGGTGTACCCAGCAGCCATGTTTGCCCCCCAGGTGGCTGCCAGGGGCGTGCCAGTGG
  CTGAATTTAACACGGAGACCACCCCAGCTACGAACAGATTCAGGTTTCATTTCCAGGGACCCTGTGGAAC
  GACTCTTCCTGAAGCCCTTGCCTGTCATGAAAATGAAACTGTTTCTTAA
  
  
• Restriction Sites: SgfI-MluI
• ACCN: NM_001242827
• ORF Size: 609 bp
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).

Reference Data

• RefSeq: NM_001242827.1, NP_001229756.1
• RefSeq Size: 4382
• RefSeq ORF: 609
• Locus ID: 23408
• Protein Families: Druggable Genome, Transcription Factors
• Gene Summary: This gene encodes a member of the sirtuin family of proteins, homologs to the yeast Sir2 protein. Members of the sirtuin family are characterized by a sirtuin core domain and grouped into four classes. The functions of human sirtuins have not yet been determined; however, yeast sirtuin proteins are known to regulate epigenetic gene silencing and suppress recombination of rDNA. Studies suggest that the human sirtuins may function as intracellular regulatory proteins with mono-ADP-ribosyltransferase activity. The protein encoded by this gene is included in class III of the sirtuin family. Alternative splicing of this gene results in multiple transcript variants. [provided by RefSeq, Jul 2010]
  Transcript Variant: This variant (4) lacks an exon in the 5' region, resulting in a downstream AUG start codon, compared to variant 1. The encoded isoform (4) has a shorter N-terminus, compared to isoform 1. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments.