ELF5 (NM_001243080) Human Untagged Clone
CAT#: SC330078
ELF5 (untagged) - Homo sapiens E74-like factor 5 (ets domain transcription factor) (ELF5), transcript variant 3
"NM_001243080" in other vectors (2)
Product Images
Other products for "ELF5"
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Symbol | ELF5 |
Synonyms | ESE2 |
Vector | pCMV6 series |
Sequence Data |
>NCBI ORF sequence for NM_001243080, the custom clone sequence may differ by one or more nucleotides
ATGTTGGACTCGGTGACACACAGCACCTTCCTGCCTAATGCATCCTTCTGCGATCCCCTGATGTCGTGGA CTGATCTGTTCAGCAATGAAGAGTACTACCCTGCCTTTGAGCATCAGACAGATGCTGATTCCAACTGCTT GAAAACAAGTGGCATCAAAAGTCAAGACTGTCACAGTCATAGTAGAACAAGCCTCCAAAGTTCTCATCTA TGGGAATTTGTACGAGACCTGCTTCTATCTCCTGAAGAAAACTGTGGCATTCTGGAATGGGAAGATAGGG AACAAGGAATTTTTCGGGTGGTTAAATCGGAAGCCCTGGCAAAGATGTGGGGACAAAGGAAGAAAAATGA CAGAATGACATATGAAAAGTTGAGCAGAGCCCTGAGATACTACTATAAAACAGGAATTTTGGAGCGGGTT GACCGAAGGTTAGTGTACAAATTTGGAAAAAATGCACACGGGTGGCAGGAAGACAAGCTATGA |
Restriction Sites | SgfI-MluI |
ACCN | NM_001243080 |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
Product Components | The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones. |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Reference Data | |
RefSeq | NM_001243080.1, NP_001230009.1 |
RefSeq Size | 2039 bp |
RefSeq ORF | 483 bp |
Locus ID | 2001 |
Cytogenetics | 11p13 |
Protein Families | Transcription Factors |
Gene Summary | 'The protein encoded by this gene is a member of an epithelium-specific subclass of the Ets transcritpion factor family. In addition to its role in regulating the later stages of terminal differentiation of keratinocytes, it appears to regulate a number of epithelium-specific genes found in tissues containing glandular epithelium such as salivary gland and prostate. It has very low affinity to DNA due to its negative regulatory domain at the amino terminus. Several alternatively spliced transcript variants encoding different isoforms have been described for this gene. [provided by RefSeq, Jul 2011]' Transcript Variant: This variant (3) differs in the 5' UTR and coding sequence and lacks two alternate in-frame exons compared to variant 1. The resulting isoform (3) has a shorter and distinct N-terminus and lacks an alternate internal segment compared to isoform 1. |
Documents
Product Manuals |
FAQs |
Resources
Other Versions
{0} Product Review(s)
0 Product Review(s)
Submit review
Be the first one to submit a review
Product Citations
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen
complexities in the preparation of your product. International customers may expect an additional 1-2 weeks
in shipping.