HSF2 (NM_001243094) Human Untagged Clone
CAT#: SC330082
HSF2 (untagged) - Homo sapiens heat shock transcription factor 2 (HSF2), transcript variant 3
"NM_001243094" in other vectors (2)
Product Images
![](https://cdn.origene.com/img/defaults-img-expression-plasmids.jpg)
Other products for "HSF2"
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Symbol | HSF2 |
Synonyms | HSF 2; HSTF 2 |
Vector | pCMV6 series |
Sequence Data |
>NCBI ORF sequence for NM_001243094, the custom clone sequence may differ by one or more nucleotides
ATGAAGCAGAGTTCGAACGTGCCGGCTTTCCTCAGCAAGCTGTGGACGCTTGTGGAGGAAACCCACACTA ACGAGTTCATCACCTGGAGCCAGAATGGCCAAAGTTTTCTGGTCTTGGATGAGCAACGATTTGCAAAAGA AATTCTTCCCAAATATTTCAAGCACAATAATATGGCAAGCTTTGTGAGGCAACTGAATATGTATGGTTTC CGTAAAGTAGTACATATCGACTCTGGAATTGTAAAGCAAGAAAGAGATGGTCCTGTAGAATTTCAGCATC CTTACTTCAAACAAGGACAGGATGACTTGTTGGAGAACATTAAAAGGAAGGTTTCATCTTCAAAACCAGA AGAAAATAAAATTCGTCAGGAAGATTTAACAAAAATTATAAGTAGTGCTCAGAAGGTTCAGATAAAACAG GAAACTATTGAGTCCAGGCTTTCTGAATTAAAAAGTGAGAATGAGTCCCTTTGGAAGGAGGTGTCAGAAT TACGAGCAAAGCATGCACAACAGCAACAAGTTATTCGAAAGATTGTCCAGTTTATTGTTACATTGGTTCA AAATAACCAACTTGTGAGTTTAAAACGTAAAAGGCCTCTACTTCTAAACACTAATGGAGCCCAAAAGAAG AACCTGTTTCAGCACATAGTCAAAGAACCAACTGATAATCATCATCATAAAGTAATTTTTTAG |
Restriction Sites | SgfI-MluI |
ACCN | NM_001243094 |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
Product Components | The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones. |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Reference Data | |
RefSeq | NM_001243094.1, NP_001230023.1 |
RefSeq Size | 1088 bp |
RefSeq ORF | 693 bp |
Locus ID | 3298 |
Cytogenetics | 6q22.31 |
Protein Families | Transcription Factors |
Gene Summary | 'The protein encoded by this gene belongs to the HSF family of transcription factors that bind specifically to the heat-shock promoter element and activate transcription. Heat shock transcription factors activate heat-shock response genes under conditions of heat or other stresses. Alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2011]' Transcript Variant: This variant (3) contains a different 3' terminal exon compared to variant 1. This results in a frame-shift and a shorter isoform (c) with a distinct C-terminus compared to isoform a. |
Documents
Product Manuals |
FAQs |
Resources
{0} Product Review(s)
0 Product Review(s)
Submit review
Be the first one to submit a review
Product Citations
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen
complexities in the preparation of your product. International customers may expect an additional 1-2 weeks
in shipping.