NARS2 (NM_001243251) Human Untagged Clone

CAT#: SC330107

NARS2 (untagged) - Homo sapiens asparaginyl-tRNA synthetase 2, mitochondrial (putative) (NARS2), transcript variant 2

Specifications

Product Data

• Type: Human Untagged Clone
• Tag: Tag Free
• Symbol: NARS2
• Synonyms: asnRS; DFNB94; SLM5
• Vector: pCMV6 series
• Sequence Data:
  Fully Sequenced ORF

  >NCBI ORF sequence for NM_001243251, the custom clone sequence may differ by one or more nucleotides
  
  
  ATGTCAGGAGCTTTTACTCAAGTGTTTACCTTTGGTCCGACCTTCCGAGCTGAAAATTCTCAGAGCCGGA
  GGCACCTGGCAGAGTTTTATATGATAGAAGCAGAGATTTCTTTTGTTGACAGCCTTCAAGATCTTATGCA
  GGTTATAGAGGAACTGTTCAAGGCTACAACAATGATGGTTCTCTCAAAATGTCCTGAAGATGTTGAACTC
  TGTCACAAATTCATAGCACCTGGCCAAAAGGACAGATTAGAACATATGCTAAAAAACAACTTTTTAATCA
  TTTCTTATACTGAAGCAGTGGAGATCTTAAAGCAAGCATCCCAGAACTTCACCTTTACCCCAGAGTGGGG
  TGCTGACCTACGGACTGAACATGAAAAGTACCTGGTGAAGCACTGTGGCAACATACCTGTCTTCGTTATT
  AATTATCCATTAACACTCAAGCCTTTCTACATGAGGGATAATGAAGATGGCCCTCAGCACACGGTTGCTG
  CTGTTGATCTTCTGGTTCCTGGAGTTGGGGAACTCTTTGGAGGAGGCCTCAGAGAAGAACGATACCATTT
  CTTAGAGGAGCGCTTAGCCAGATCGGGACTTACAGAAGTCTACCAATGGTATCTGGACCTTCGTCGATTT
  GGATCTGTGCCACATGGAGGTTTTGGGATGGGATTTGAACGCTACCTGCAGTGCATCTTGGGTGTTGACA
  ATATCAAAGATGTTATCCCTTTCCCAAGGTTTCCTCATTCATGCCTTTTATAG
  
  
• Restriction Sites: SgfI-MluI
• ACCN: NM_001243251
• ORF Size: 753 bp
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).

Reference Data

• RefSeq: NM_001243251.1, NP_001230180.1
• RefSeq Size: 2038
• RefSeq ORF: 753
• Locus ID: 79731
• Protein Pathways: Aminoacyl-tRNA biosynthesis
• Gene Summary: This gene encodes a putative member of the class II family of aminoacyl-tRNA synthetases. These enzymes play a critical role in protein biosynthesis by charging tRNAs with their cognate amino acids. This protein is encoded by the nuclear genome but is likely to be imported to the mitochondrion where it is thought to catalyze the ligation of asparagine to tRNA molecules. Mutations in this gene have been associated with combined oxidative phosphorylation deficiency 24 (COXPD24). [provided by RefSeq, Mar 2015]
  Transcript Variant: This variant (2) differs in the 5' UTR, lacks a portion of the 5' coding region and uses a downstream, in-frame start codon, compared to variant 1. The encoded isoform (2) has a shorter N-terminus, compared to isoform 1. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments.