Glutaredoxin 2 (GLRX2) (NM_001243399) Human Untagged Clone

CAT#: SC330120

GLRX2 (untagged) - Homo sapiens glutaredoxin 2 (GLRX2), transcript variant 3

Specifications

Product Data

• Type: Human Untagged Clone
• Tag: Tag Free
• Symbol: GLRX2
• Synonyms: CGI-133; GRX2
• Vector: pCMV6 series
• Sequence Data:
  Fully Sequenced ORF

  >NCBI ORF sequence for NM_001243399, the custom clone sequence may differ by one or more nucleotides
  
  
  ATGGAGAGCAATACATCATCATCTTTGGAGAATTTAGCGACGGCGCCTGTGAACCAGATCCAAGAAACAA
  TTTCTGATAATTGTGTGGTGATTTTCTCAAAAACATCCTGTTCTTACTGTACAATGGCAAAAAAGCTTTT
  CCATGACATGAATGTTAACTATAAAGTGGTGGAACTGGACCTGCTTGAATATGGAAACCAGTTCCAAGAT
  GCTCTTTACAAAATGACTGGTGAAAGAACTGTTCCAAGAATATTTGTCAATGGTACTTTTATTGGAGGTG
  CAACTGACACTCATAGGCTTCACAAAGAAGGAAAATTGCTCCCACTAGTTCATCAGTGTTATTTAAAAAA
  AAGTAAGAGGAAAGAATTTCAGTGA
  
  
• Restriction Sites: SgfI-MluI
• ACCN: NM_001243399
• ORF Size: 375 bp
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).

Reference Data

• RefSeq: NM_001243399.1, NP_001230328.1
• RefSeq Size: 976
• RefSeq ORF: 375
• Locus ID: 51022
• Protein Families: Transcription Factors
• Gene Summary: The protein encoded by this gene is a member of the glutaredoxin family of proteins, which maintain cellular thiol homeostasis. These proteins are thiol-disulfide oxidoreductases that use a glutathione-binding site and one or two active cysteines in their active site. This gene undergoes alternative splicing to produce multiple isoforms, one of which is ubiquitously expressed and localizes to mitochondria, where it functions in mitochondrial redox homeostasis and is important for the protection against and recovery from oxidative stress. Other isoforms, which have more restrictive expression patterns, show cytosolic and nuclear localization, and are thought to function in cellular differentiation and transformation, possibly with a role in tumor progression. [provided by RefSeq, Aug 2011]
  Transcript Variant: This variant (3) differs in the 5' UTR, lacks a portion of the 5' coding region, and uses a downstream in-frame start codon, compared to variant 1. The encoded isoform (3, also known as Grx2c) is shorter at the N-terminus, compared to isoform 1.